109 resultados para RAY SOLUTION SCATTERING

em CentAUR: Central Archive University of Reading - UK


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The use of high-energy X-ray total scattering coupled with pair distribution function analysis produces unique structural fingerprints from amorphous and nanostructured phases of the pharmaceuticals carbamazepine and indomethacin. The advantages of such facility-based experiments over laboratory-based ones are discussed and the technique is illustrated with the characterisation of a melt-quenched sample of carbamazepine as a nanocrystalline (4.5 nm domain diameter) version of form III.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.

Relevância:

50.00% 50.00%

Publicador:

Resumo:

A novel capillary flow device has been developed and applied to study the orientation of worm-like micelles, among other systems. Small-angle X-ray scattering (SAXS) data from micelles formed by a Pluronic block copolymer in aqueous salt solution provides evidence for the formation of worm-like micelles, which align under flow. A transition from a rod-like form factor to a less persistent conformation is observed under flow. Flow alignment of worm-like micelles formed by the low molar mass amphiphile system cetyl pyridinium chloride+sodium salicylate is studied for comparative purposes. Here, inhomogenous flow at the micron scale is revealed by streaks in the small-angle light scattering pattern perpendicular to the flow direction. Copyright (c) 2006 John Wiley & Sons, Ltd.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The self-assembly in films dried from aqueous solutions of a modified amyloid beta peptide fragment is studied. We focus on sequence A beta(16-20), KLVFF, extended by two alanines at the N-terminus to give AAKLVFF. Self-assembly into twisted ribbon fibrils is observed, as confirmed by transmission electron microscopy (TEM). Dynamic light scattering reveals the semi-flexible nature of the AAKLVFF fibrils, while polarized optical microscopy shows that the peptide fibrils crystallize after an aqueous solution of AAKLVFF is matured over 5 days. The secondary structure of the fibrils is studied by FT-IR, circular dichroism and X-ray diffraction (XRD), which provide evidence for beta-sheet structure in the fibril. From high resolution TEM it is concluded that the average width of an AAKLVFF fibril is (63 +/- 18) nm, indicating that these fibrils comprise beta-sheets with multiple repeats of the unit cell, determined by XRD to have b and c dimensions 1.9 and 4.4 nm with an a axis 0.96 nm, corresponding to twice the peptide backbone spacing in the antiparallel beta-sheet. (C) 2008 Elsevier B.V. All rights reserved.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The self-assembly into wormlike micelles of a poly(ethylene oxide)-b-poly(propylene oxide)-b-poly(ethylene oxide) triblock copolymer Pluronic P84 in aqueous salt solution (2 M NaCl) has been studied by rheology, small-angle X-ray and neutron scattering (SAXS/SANS), and light scattering. Measurements of the flow curves by controlled stress rheometry indicated phase separation under flow. SAXS on solutions subjected to capillary flow showed alignment of micelles at intermediate shear rates, although loss of alignment was observed for high shear rates. For dilute solutions, SAXS and static light scattering data on unaligned samples could be superposed over three decades in scattering vector, providing unique information on the wormlike micelle structure over several length scales. SANS data provided information on even shorter length scales, in particular, concerning "blob" scattering from the micelle corona. The data could be modeled based on a system of semiflexible self-avoiding cylinders with a circular cross-section, as described by the wormlike chain model with excluded volume interactions. The micelle structure was compared at two temperatures close to the cloud point (47 degrees C). The micellar radius was found not to vary with temperature in this region, although the contour length increased with increasing temperature, whereas the Kuhn length decreased. These variations result in an increase of the low-concentration radius of gyration with increasing temperature. This was consistent with dynamic light scattering results, and, applying theoretical results from the literature, this is in agreement with an increase in endcap energy due to changes in hydration of the poly(ethylene oxide) blocks as the temperature is increased.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The self-assembly in aqueous solution of hybrid block copolymers consisting of amphiphilic β-strand peptide sequences flanked by one or two PEG chains was investigated by means of circular dichroism spectroscopy, small-angle X-ray scattering, and transmission electron microscopy. In comparison with the native peptide sequence, it was found that the peptide secondary structure was stabilized against pH variation in the di-and tri-block copolymers with PEG. Small-angle X-ray scattering indicated the presence of fibrillar structures, the dimensions of which are comparable to the estimated width of a β-strand (with terminal PEG chains in the case of the copolymers). Transmission electron microscopy on selectively stained and dried specimens shows directly the presence of fibrils. It is proposed that these fibrils result from the hierarchical self-assembly of peptide β-strands into helical tapes, which then stack into fibrils.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The crystallization of well-defined poly(L-lactide)-b-poly(epsilon-caprolactone) diblock copolymers, PLLA-b-PCL, was investigated by time-resolved X-ray techniques, polarized optical microscopy (POM), and differential scanning calorimetry (DSC). Two compositions were studied that contained 44 and 60 wt % poly(L-lactide), PLLA (they are referred to as (L44C5614)-C-11 and (L60C409)-C-12, respectively, with the molecular weight of each block in kg/mol as superscript). The copolymers were found to be initially miscible in the melt according to small-angle X-ray scattering measurements (SAXS). Their thermal behavior was also indicative of samples whose crystallization proceeds from a mixed melt. Sequential isothermal crystallization from the melt at 100 degreesC (for 30 min) and then at 30 degreesC (for 15 min) was measured. At 100 degreesC only the PLLA block is capable of crystallization, and its crystallization kinetics was followed by both WAXS and DSC; comparable results were obtained that indicated an instantaneous nucleation with three-dimensional superstructures (Avrami index of approximately 3). The spherulitic nature of the superstructure was confirmed by POM. When the temperature was decreased to 30 degreesC, the PCL block was able to crystallize within the PLLA negative spherulites (with an Avrami index of 2, as opposed to 3 in homo-PCL), and its crystallization rate was much slower than an equivalent homo-PCL. Time-resolved SAXS experiments in (L60C409)-C-12 revealed an initial melt mixed morphology at 165 degreesC that upon cooling transformed into a transient microphase-separated lamellar structure prior to crystallization at 100 degreesC.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

We have investigated the effect of sample hydration on the wide-angle X-ray scattering patterns of amyloid fibrils from two different sources, hen egg white lysozyme (HEWL) and an 11-residue peptide taken from the sequence of transthyretin (TTR105-115). Both samples show an inter-strand reflection at 4.7 Å and an inter-sheet reflection which occurs at 8.8 and 10 Å for TTR105-115 and HEWL fibrils, respectively. The positions, widths, and relative intensities of these reflections are conserved in patterns obtained from dried stalks and hydrated samples over a range of fibril concentrations. In 2D scattering patterns obtained from flow-aligned hydrated samples, the inter-strand and inter-sheet reflections showed, respectively, axial and equatorial alignment relative to the fibril axis, characteristic of the cross-β structure. Our results show that the cross-β structure of the fibrils is not a product of the dehydrating conditions typically employed to produce aligned samples, but is conserved in individual fibrils in hydrated samples under dilute conditions comparable to those associated with other biophysical and spectroscopic techniques. This suggests a structure consisting of a stack of two or more sheets whose interfaces are inaccessible to bulk water.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

WThe capillary flow alignment of the thermotropic liquid crystal 4-n-octyl-4′-cyanobiphenyl in the nematic and smectic phases is investigated using time-resolved synchrotron small-angle x-ray scattering. Samples were cooled from the isotropic phase to erase prior orientation. Upon cooling through the nematic phase under Poiseuille flow in a circular capillary, a transition from the alignment of mesogens along the flow direction to the alignment of layers along the flow direction (mesogens perpendicular to flow) appears to occur continuously at the cooling rate applied. The transition is centered on a temperature at which the Leslie viscosity coefficient α3 changes sign. The configuration with layers aligned along the flow direction is also observed in the smectic phase. The transition in the nematic phase on cooling has previously been ascribed to an aligning-nonaligning or tumbling transition. At high flow rates there is evidence for tumbling around an average alignment of layers along the flow direction. At lower flow rates this orientation is more clearly defined. The layer alignment is ascribed to surface-induced ordering propagating into the bulk of the capillary, an observation supported by the parallel alignment of layers observed for a static sample at low temperatures in the nematic phase.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

An aqueous solution of a poly(ethylene glycol)-polycaprolactone-poly(ethylene glycol) (PEG-PCL-PEG) with a composition of EG13CL23EG13 undergoes multiple transitions, from sol-to-gel (hard gel)-to-sol-to-gel (soft gel)-to-sol, in the concentration range 20.0∼35.0 wt.-%. Through dynamic mechanical analysis, UV-vis spectrophotometry, small angle X-ray scattering, differential scanning calorimetry, microcalorimetry and 13C NMR spectroscopy, the mechanism of these transitions was investigated. The hard gel and soft gel are distinguished by the crystalline and amorphous state of the PCL. The extent of PEG dehydration and the molecular motion of each block also played a critical role in the multiple transitions. This paper suggests a new mechanism for these multiple transitions driven by temperature changes.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Tethered deuterated polystyrene-block-polymethyl methacrylate films have been examined by X-ray scattering both in their native state and following treatment with ruthenium tetroxide. The use of the stain, while increasing the thickness of the films, does not significantly alter the lateral structure or periodicity of the films and provides contrast between the two blocks. Both the periodicity of the films and the structure normal to the surface have been identified following staining. Experiments were also performed on films treated by a solvent exchange process, and the effects of staining on these films are discussed.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The evolution of the global orientation parameter for a series of aqueous hydroxypropylcellulose solutions both during and following the cessation of a steady-state shear flow is reported. Time-resolved orientation measurements were made in situ through a novel X-ray rheometer coupled with a two-dimensional electronic X-ray camera, and using an intense X-ray source at the LURE synchrotron. After the cessation of flow, the global orientation decreases from the steady-state orientation level to zero following shear flow at low shear rate or to a small but finite value after flow at a high shear rate. The decrease of orientation with time shows different behaviour, dependent upon the previously applied shear rate.