Structure of AuCN determined from total neutron diffraction

The structure of gold cyanide, AuCN, has been determined at 10 and 300 K using total neutron diffraction. The structure consists of infinite -Au-(CN)-Au-(CN)-Au-(CN)- linear chains, hexagonally packed, with the gold atoms in sheets. The Au-C and Au-N bond lengths are found to be identical, with d(Au-C/N) = 1.9703(5) Angstrom at 300 K. This work supersedes a previous study, by others, which used Rietveld analysis of neutron Bragg diffraction in isolation, and found these bonds to have significantly different lengths (Deltad = 0.24 Angstrom) at 300 K. The total correlation function, T(r), at 10 and 300 K, has been modeled using information derived from total diffraction. The broadening of inter- and intrachain correlations differs markedly due to random displacements of the chains in the direction of the chain axes. This is a consequence of the relatively weak bonding between the chains. An explanation for the negative thermal expansion in the c-direction, which occurs between 10 and 300 K, is presented.

Modeling the structure of amorphous MoS3: a neutron diffraction and reverse Monte Carlo study

A model for the structure of amorphous molybdenum trisulfide, a-MoS3, has been created using reverse Monte Carlo methods. This model, which consists of chains Of MoS6 units sharing three sulfurs with each of its two neighbors and forming alternate long, nonbonded, and short, bonded, Mo-Mo separations, is a good fit to the neutron diffraction data and is chemically and physically realistic. The paper identifies the limitations of previous models based on Mo-3 triangular clusters in accounting for the available experimental data.

A powder neutron diffraction study of the metallic ferromagnet Co3Sn2S2

Variable-temperature powder neutron diffraction data reveal that Co3Sn2S2 crystallizes in the shandite structure (space group R (3) over barm, a = 5.36855(3)angstrom, c = 13.1903(1) angstrom at 300 K). The structural relationship between Co3Sn2S2 and the intermetallic compound CoSn, both of which contain Kagome nets of cobalt atoms, is discussed. Resistivity and Seebeck coefficient measurements for Co3Sn2S2 are consistent with metallic behaviour. Magnetic susceptibility measurements indicate that Co3Sn2S2 orders ferromagnetically at 180(10) K, with a saturation moment of 0.29 mu(B) per cobalt atom at 5 K. The onset of magnetic ordering is accompanied by marked anomalies in the electrical transport properties. (c) 2008 Elsevier Masson SAS. All rights reserve

New insights into the compressibility and high-pressure stability of Ni(CN)2: a combined study of neutron diffraction, Raman spectroscopy, and inelastic neutron scattering

Nickel cyanide is a layered material showing markedly anisotropic behaviour. High-pressure neutron diffraction measurements show that at pressures up to 20.1 kbar, compressibility is much higher in the direction perpendicular to the layers, c, than in the plane of the strongly chemically bonded metal-cyanide sheets. Detailed examination of the behaviour of the tetragonal lattice parameters, a and c, as a function of pressure reveal regions in which large changes in slope occur, for example, in c(P) at 1 kbar. The experimental pressure dependence of the volume data is fitted to a bulk modulus, B0, of 1050 (20) kbar over the pressure range 0–1 kbar, and to 124 (2) kbar over the range 1–20.1 kbar. Raman spectroscopy measurements yield additional information on how the structure and bonding in the Ni(CN)2 layers change with pressure and show that a phase change occurs at about 1 kbar. The new high-pressure phase, (Phase PII), has ordered cyanide groups with sheets of D4h symmetry containing Ni(CN)4 and Ni(NC)4 groups. The Raman spectrum of phase PII closely resembles that of the related layered compound, Cu1/2Ni1/2(CN)2, which has previously been shown to contain ordered C≡N groups. The phase change, PI to PII, is also observed in inelastic neutron scattering studies which show significant changes occurring in the phonon spectra as the pressure is raised from 0.3 to 1.5 kbar. These changes reflect the large reduction in the interlayer spacing which occurs as Phase PI transforms to Phase PII and the consequent increase in difficulty for out-of-plane atomic motions. Unlike other cyanide materials e.g. Zn(CN)2 and Ag3Co(CN)6, which show an amorphization and/or a decomposition at much lower pressures (~100 kbar), Ni(CN)2 can be recovered after pressurising to 200 kbar, albeit in a more ordered form.

Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Structure determination from powder diffraction data

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

Structure determination from powder diffraction data

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

Three dimensional picture of the local structure of 1,4-Polybutadiene from a complete atomistic model and neutron scattering data

An efficient method of combining neutron diffraction data over an extended Q range with detailed atomistic models is presented. A quantitative and qualitative mapping of the organization of the chain conformation in both glass and liquid phase has been performed. The proposed structural refinement method is based on the exploitation of the intrachain features of the diffraction pattern by the use of internal coordinates for bond lengths, valence angles and torsion rotations. Models are built stochastically by assignment of these internal coordinates from probability distributions with limited variable parameters. Variation of these parameters is used in the construction of models that minimize the differences between the observed and calculated structure factors. A series of neutron scattering data of 1,4-polybutadiene at the region 20320 K is presented. Analysis of the experimental data yield bond lengths for C-C and C=C of 1.54 and 1.35 Å respectively. Valence angles of the backbone were found to be at 112 and 122.8 for the CCC and CC=C respectively. Three torsion angles corresponding to the double bond and the adjacent R and β bonds were found to occupy cis and trans, s(, trans and g( and trans states, respectively. We compare our results with theoretical predictions, computer simulations, RIS models, and previously reported experimental results.

A complete atomistic model of molten polyethylene from neutron scattering data: a new methodology for polymer structure

A new approach to the study of the local organization in amorphous polymer materials is presented. The method couples neutron diffraction experiments that explore the structure on the spatial scale 1–20 Å with the reverse Monte Carlo fitting procedure to predict structures that accurately represent the experimental scattering results over the whole momentum transfer range explored. Molecular mechanics and molecular dynamics techniques are also used to produce atomistic models independently from any experimental input, thereby providing a test of the viability of the reverse Monte Carlo method in generating realistic models for amorphous polymeric systems. An analysis of the obtained models in terms of single chain properties and of orientational correlations between chain segments is presented. We show the viability of the method with data from molten polyethylene. The analysis derives a model with average C-C and C-H bond lengths of 1.55 Å and 1.1 Å respectively, average backbone valence angle of 112, a torsional angle distribution characterized by a fraction of trans conformers of 0.67 and, finally, a weak interchain orientational correlation at around 4 Å.