Presubmergence and green manure affect the transformations of nitrogen-15-labeled urea under lowland soil conditions

The effect of presubmergence and green manuring on various processes involved in [N-15]-urea transformations were studied in a growth chamber after [N-15]-urea application to floodwater. Presubmergence for 14 days increased urea hydrolysis rates and floodwater pH, resulting in higher NH3 volatilization as compared to without presubmergence. Presubmergence also increased nitrification and subsequent denitrification but lower N assimilation by floodwater algae caused higher gaseous losses. Addition of green manure maintained higher NH4+-N concentration in floodwater mainly because of lower nitrification rates but resulted in highest NH3 volatilization losses. Although green manure did not affect the KCl extractable NH4+-N from applied fertilizer, it maintained higher NH4+-N content due to its decomposition and increased mineralization of organic N. After 32 days about 36.9% (T-1), 23.9% (T-2), and 36.4% (T-3) of the applied urea N was incorporated in the pool of soil organic N in treatments. It was evident that the presubmergence has effected the recovery of applied urea N.

Saturated salt solutions for humidity control and the survival of dry powder and oil formulations of Beauveria bassiana conidia

Oil-based formulated conidia sprayed on steel plates and conidia powder (control) of Beauveria bassiana isolate IMI 386243 were stored at temperatures from 10 to 40 degrees C in desiccators over saturated salt solutions providing relative humidities from 32 to 88%, or in hermetic storage at 40 degrees C, and moisture contents in equilibrium with 33 or 77% relative humidity. The negative semi-logarithmic relation (P < 0.005) between conidia longevity (at 40 degrees C) and equilibrium relative humidity did not differ (P > 0.25) between formulated conidia and conidia powder. Despite this, certain saturated salts provided consistently greater longevity (NaCl) and others consistently shorter longevity (KCl) for formulated conidia compared to conidia powder. These results, analysis of previous data, and comparison with hermetic storage, indicate that storage of conidia over saturated salt solutions provides inconsistent responses to environment and so may be problematic for bio-pesticide research. In hermetic storage, oil formulation was not deleterious to longevity and in the more moist environment enhanced survival periods. (c) 2005 Elsevier Inc. All rights reserved.

Electrochemical determination of plant-derived leuco-indigo after chemical reduction by glucose

Electrochemical determination of redox active dye species is demonstrated in indigo samples contaminated with high levels of organic and inorganic impurities. The use of a hydrodynamic electrode system based on a vibrating probe (250 Hz, 200 mu m lateral amplitude) allows time-independent diffusion controlled signals to be enhanced and reliable concentration data to be obtained under steady state conditions at relatively fast scan rates up to 4 V s-1In this work the indigo content of a complex plant-derived indigo sample (dye content typically 30%) is determined after indigo is reduced by addition of glucose in aqueous 0.2 M NaOH. The soluble leuco-indigo is measured by its oxidation response at a vibrating electrode. The vibrating electrode, which consisted of a laterally vibrating 500 mu m diameter gold disc, is calibrated with Fe(CN)(6) 3-/4- in 0.1 M KCl and employed for indigo determination at 55, 65, and 75 C in 0.2 M NaOH. Determinations of the indigo content of 25 different samples of plant-derived indigo are compared with those obtained by conventional spectrophotometry. This comparison suggests a significant improvement by the electrochemical method, which appears to be less sensitive to impurities.

Dinuclear copper and zinc complexes of a hexaazamacrocycle containing p-xylyl spacers and bridging anions: theoretical and spectroscopic studies

The hexaazamacrocycle 7,22-dimethyl-3,7,11,18,22,26-hexaazatricyclo[26.2.2.2(13,16)] tetratriaconta-1(30), 13,15,28,31,33- hexaene (Me-2[30] pbz(2)N(6)) was synthesized and characterised by single crystal X-ray diffraction. The macrocycle adopts a conformation with the two aromatic rings almost parallel at a distance of ca. 4.24 Angstrom, but displaced relative to each other by ca. 1.51 Angstrom. The protonation constants of this compound and the stability constants of its complexes with Cu2+ and Zn2+, were determined in water - methanol (9 : 1 v/v) at 25 degreesC with ionic strength 0.10 mol dm(-3) in KCl. The potentiometric and spectroscopic studies (NMR of zinc, cadmium and lead complexes, and EPR of the copper complexes) indicate the formation of only dinuclear complexes. The association constants of the dinuclear copper complex with anions ( thiocyanate, terephthalate and glyphosate) and neutral molecules (1,4-benzenedimethanol, p-xylylenediamine and terephthalic acid) were determined at 20 degreesC in methanol. The structural preferences of this ligand and of its dinuclear copper(II) complex with a variety of bridging ligands were evaluated theoretically by molecular mechanics calculations (MM) and molecular dynamics (MD) using quenching techniques.

Binding studies of a protonated dioxatetraazamacrocycle with carboxylate substrates

The tetraprotonated form of the dioxatetraazamacrocycle, 6,19-dioxa-3,9,16,22-tetraaza[22.2.2.2(11,14)]-triaconta-1(26),11,13,24, 27,29-hexaene, (H4L1)(4+), was used as the receptor for binding studies with carboxylate anionic substrates of different shapes, sizes, and charges [succinate (suc(2-)), cyclo- hexanetricarboxylate (cta(3-)), phthalate (ph(2-)), isophthalate (iph(2-)), terephthalate (tph(2-)), and benezenetricarboxylate (btc(3-))]. Association constants were determined by potentiometry in aqueous solution at 298.2 K and 0.10 M KCl and by H-1 NMR titration in D2O. The strongest association was found for the btc3- anion at 5-7 pH region. From both techniques it was possible to establish the binding preference trend of the receptor for the different substrates, and the H-1 NMR spectroscopy gave important suggestions about the type of interactions between partners and the location of the substrates in the supramolecular entities formed. The effective binding constants at pH 6 follow the order: btc(3-)>iph(2-)>cta(3-) =ph(2-)>tph(2-)>suc(2-). All the studies suggest that the anionic substrates bind to the receptor via N-H center dot center dot center dot O = C hydrogen bonds and electrostatic interactions, and the aromatic substrates can also establish pi-pi stacking interactions. The crystal structures of (H4L1)(4+) and its supramolecular assemblies with ph(2-) and tph(2-) were determined by X-ray diffraction. The last two structures showed that the association process in solid state occurs via multiple N-H center dot center dot center dot O = C hydrogen bonds with the anionic substrate located outside the macrocyclic cavity of the receptor. Molecular dynamics simulations carried out for the association of (H4L1)(4+) with tph(2-) and btC(3-) in water solution established at atomic level the existence of all interactions suggested by the experimental studies, which act cooperatively in the binding process. Furthermore, the binding free energies were estimated and the values are in agreement with the experimental ones, indicating that the binding of these two anionic substrates occurs into the receptor cavity. However, the tph(2-) has also propensity to leave the macrocyclic cavity and its molecular recognition can also happen at the top of the receptor. (C) 2008 Elsevier Ltd. All rights reserved.

Bending, twisting, and breaking CuCN chains to produce framework materials: the reactions of CuCN with alkali-metal halides

The reactions of the low-temperature polymorph of copper(I) cyanide (LT-CuCN) with concentrated aqueous alkali-metal halide solutions have been investigated. At room temperature, KX (X = Br and I) and CsX (X = Cl, Br, and I) produce the addition products K[Cu-2(CN)(2)Br](H2O)-H-. (I), K-3[Cu-6(CN)(6)I-3](.)2H(2)O (II), Cs[Cu-3(CN)(3)Cl] (III), Cs[Cu-3(CN)(3)Br] (IV), and Cs-2[Cu-4(CN)(4)I-2](H2O)-H-. (V), with 3-D frameworks in which the -(CuCN)- chains present in CuCN persist. No reaction occurs, however, with NaX (X = Cl, Br, I) or KCl. The addition compounds, I-V, reconvert to CuCN when washed. Both low- and high-temperature polymorphs of CuCN (LT- and HT-CuCN) are produced, except in the case of Cs[Cu-3(CN)(3)Cl] (III), which converts only to LT-CuCN. Heating similar AX-CuCN reaction mixtures under hydrothermal conditions at 453 K for 1 day produces single crystals of I-V suitable for structure determination. Under these more forcing conditions, reactions also occur with NaX (X = Cl, Br, I) and KCl. NaBr and KCl cause some conversion of LT-CuCN into HT-CuCN, while NaCl and NaI, respectively, react to form the mixed-valence Cu(I)/Cu(II) compounds [Cu-II(OH2)(4)][Cu-4(I)(CN)(6)], a known phase, and [Cu-II(OH2)(4)][Cu-4(I)(CN)(4)I-2] (VI), a 3-D framework, which contains infinite -(CuCN)- chains. After 3 days of heating under hydrothermal conditions, the reaction between KI and CuCN produces [Cu-II(OH2)(4)][Cu-2(I)(CN)I-2](2) (VII), in which the CuCN chains are broken into single Cu-CN-Cu units, which in turn are linked into chains via iodine atoms and then into layers via long Cu-C and Cu-Cu interactions.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Peroxy radical partitioning during the AMMA radical intercomparison exercise

Peroxy radicals were measured onboard two scientific aircrafts during the AMMA (African Monsoon Multidisciplinary Analysis) campaign in summer 2006. This paper reports results from the flight on 16 August 2006 during which measurements of HO2 by laser induced fluorescence spectroscopy at low pressure (LIF-FAGE) and total peroxy radicals (RO2* = HO2+ΣRO2, R = organic chain) by two similar instruments based on the peroxy radical chemical amplification (PeRCA) technique were subject of a blind intercomparison. The German DLR-Falcon and the British FAAM-BAe-146 flew wing tip to wing tip for about 30 min making concurrent measurements on 2 horizontal level runs at 697 and 485 hPa over the same geographical area in Burkina Faso. A full set of supporting measurements comprising photolysis frequencies, and relevant trace gases like CO, NO, NO2, NOy, O3 and a wider range of VOCs were collected simultaneously. Results are discussed on the basis of the characteristics and limitations of the different instruments used. Generally, no data bias are identified and the RO2* data available agree quite reasonably within the instrumental errors. The [RO2*]/[HO2] ratios, which vary between 1:1 and 3:1, as well as the peroxy radical variability, concur with variations in photolysis rates and in other potential radical precursors. Model results provide additional information about dominant radical formation and loss processes.

Preparation and magnetic properties of La–Mn and La–Co doped barium hexaferrites prepared via an improved co-precipitation/molten salt method

LaMn and LaCo doped barium hexaferrites of formula Ba(1-x)LaxFe(12-x)MxO19 (M=Mn, Co) (x=0.05 to 0.40) were prepared with an improved co-precipitation/molten salt method. For the synthesis, aqueous solutions of the appropriate metal chlorides were prepared in the ratio required except that the initial mole ratio of Fe and dopants to Ba was chosen to be 11:1, and then mixed with excess Na2CO3. The solutions were then cooled, filtered off, dried, then mixed with KCl flux, and heated at 450 degrees C and for 2 h. The temperature was then raised to 950 degrees C and kept for 4 h, then cooled. This new synthesis method, which employs a lower temperature and shorter reaction time, gives products with improved crystallinity and purity while the saturation magnetization and coercivity values are comparable with those synthesized via the high temperature method.

The Henslowe-Allyen Digitisation Project

2000 digital photographs of manuscript pages in the single most inportant theatrical archive in the age of Shakespeare, as well as 15 digital essays by world-leading scholars

Salts responsive nanovesicles through π-stacking induced self-assembly of backbone modified tripeptides

A set of backbone modified peptides of general formula Boc-Xx-m-ABA-Yy-OMe where m-ABA is meta-aminobenzoic acid and Xx and Yy are natural amino acids such as Phe, Gly, Pro, Leu, Ile, Tyr and Trp etc., are found to self-assemble into soft nanovesicular structures in methanol-water solution (9:1 by v/v). At higher concentration the peptides generate larger vesicles which are formed through fusion of smaller vesicles. The formation of vesicles has been facilitated through the participation of various noncovalent interactions such as aromatic pi-stacking, hydrogen bonding and hydrophobic interactions. Model study indicates that the pi-stacking induced self-assembly, mediated by m-ABA is essential for well structured vesicles formation. The presence of conformationally rigid m-ABA in the backbone of the peptides also helps to form vesicular structures by restricting the conformational entropy. The vesicular structures get disrupted in presence of various salts such as KCl, CaCl(2), N(n-Bu)(4)Br and (NH(4))(2)SO(4) in methanol-water solution. Fluorescence microscopy and UV studies reveal that the soft nanovesicles encapsulate organic dye molecules such as Rhodamine B and Acridine Orange which could be released through salts induced disruption of vesicles.

Neurogenic responses mediated by vanilloid receptor-1 (TRPV1) are blocked by the high affinity antagonist, iodo-resiniferatoxin

(1) Stimulation of the vanilloid receptor-1 (TRPV1) results in the activation of nociceptive and neurogenic inflammatory responses. Poor specificity and potency of TRPV1 antagonists has, however, limited the clarification of the physiological role of TRPV1. (2) Recently, iodo-resiniferatoxin (I-RTX) has been reported to bind as a high affinity antagonist at the native and heterologously expressed rat TRPV1. Here we have studied the ability of I-RTX to block a series of TRPV1 mediated nociceptive and neurogenic inflammatory responses in different species (including transfected human TRPV1). (3) We have demonstrated that I-RTX inhibited capsaicin-induced mobilization of intracellular Ca(2+) in rat trigeminal neurons (IC(50) 0.87 nM) and in HEK293 cells transfected with the human TRPV1 (IC(50) 0.071 nM). (4) Furthermore, I-RTX significantly inhibited both capsaicin-induced CGRP release from slices of rat dorsal spinal cord (IC(50) 0.27 nM) and contraction of isolated guinea-pig and rat urinary bladder (pK(B) of 10.68 and 9.63, respectively), whilst I-RTX failed to alter the response to high KCl or SP. (5) Finally, in vivo I-RTX significantly inhibited acetic acid-induced writhing in mice (ED(50) 0.42 micro mol kg(-1)) and plasma extravasation in mouse urinary bladder (ED(50) 0.41 micro mol kg(-1)). (6) In in vitro and in vivo TRPV1 activated responses I-RTX was approximately 3 log units and approximately 20 times more potent than capsazepine, respectively. This high affinity antagonist, I-RTX, may be an important tool for future studies in pain and neurogenic inflammatory models.