18 resultados para Instrumentation for fluorescence emission studies

em CentAUR: Central Archive University of Reading - UK


Relevância:

100.00% 100.00%

Publicador:

Resumo:

A new tri-functional ligand (Bu2NCOCH2SO2CH2CONBu2)-Bu-i-Bu-i (L) was prepared and characterized. The coordination chemistry of this ligand with uranyl nitrate was studied with IR, (HNMR)-H-1, ES-MS, TG and elemental analysis methods. The structure of the compound [UO2(NO3)(2)L] was determined by single crystal X-ray diffraction techniques. In the structure the uranium(VI) ion is surrounded by eight oxygen atoms in a hexagonal bi-pyramidal geometry. Four oxygen atoms from two nitrate groups and two oxygen atoms from the ligand form a planar hexagon. The ligand acts as a bidentate chelate and bonds through both the carbamoyl groups to the uranyl nitrate. An ES-MS spectrum shows that the complex retains the bonding in solution. The compound displayed vibronically coupled fluorescence emission.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The synthesis and structural characterization of a novel oxoperoxovanadium(v) complex [VO(O-2)(PAH)-(phen)] containing the ligands 2-phenylacetohydroxamic acid (PAHH) and 1,10-phenanthroline (phen) has been accomplished. The oxoperoxovanadium(v) complex was found to mimic both vanadate-dependent haloperoxidase (VHPO) activity as well as nuclease activity through effective interaction with DNA. The complex is the first example of a structurally characterized stable oxoperoxovanadium(v) complex with a coordinated bi-dentate hydroximate moiety (-CONHO-) from 2-phenylacetohydroximate (PAH). The oxoperoxovanadium(v) complex has been used as catalyst for the peroxidative bromination reaction of some unsaturated alcohols (e.g. 4-pentene-1-ol, 1-octene-3-ol and 9-decene-1-ol) in the presence of H2O2 and KBr. The catalytic products have been characterized by GC-MS analysis and spectrophotometric methods. The DNA binding of this complex has been established with CT DNA whereas the DNA cleavage was demonstrated with plasmid DNA. The interactions of the complex with DNA have been monitored by electronic absorption and fluorescence emission spectroscopy. Viscometric measurements suggest that the compound is a DNA intercalator. The nuclease activity of this complex was confirmed by gel electrophoresis studies.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We introduce semiconductor quantum dot-based fluorescence imaging with approximately 2-fold increased optical resolution in three dimensions as a method that allows both studying cellular structures and spatial organization of biomolecules in membranes and subcellular organelles. Target biomolecules are labelled with quantum dots via immunocytochemistry. The resolution enhancement is achieved by three-photon absorption of quantum dots and subsequent fluorescence emission from a higher-order excitonic state. Different from conventional multiphoton microscopy, this approach can be realized on any confocal microscope without the need for pulsed excitation light. We demonstrate quantum dot triexciton imaging (QDTI) of the microtubule network of U373 cells, 3D imaging of TNF receptor 2 on the plasma membrane of HeLa cells, and multicolor 3D imaging of mitochondrial cytochrome c oxidase and actin in COS-7 cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The synthesis of a series of poly(aromatic amide) dendrimers up to the second generation is described herein. The AB, building block used throughout the synthesis of the dendrimers was the allyl ester of 3,5-diaminocinnamic acid, which has been synthesized from 3,5-dinitrobenzoic acid in good yield with use of a four-step procedure. Dendron synthesis was achieved via a convergent approach with use of a sequence of deprotection/coupling steps. Two commercially available alcohols, L-menthol and citronellol, were coupled to the AB(2) monomer by using an alkyl diacid spacer and two core units; 1,7-diaminoheptane and tris(2-aminoethyl)amine have been used to produce the final dendrimers. Characterization was carried out by NMR and IR spectroscopies, MALDI-TOF mass spectrometry, GPC, and DSC. The novel monomer and dendritic derivatives exhibited a strong fluorescence emission in the visible region (lambda approximate to 500 nm) of the spectrum and a weak emission in the near-infrared (lambda approximate to 850 nm) upon excitation in the near-UV region. The fluorescence emission characteristics were found to be solvent and dendrimer generation dependent.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The antioxidant activity of hydroxytyrosol, hydroxytyrosol acetate, oleuropein, 3,4-dihydroxyphenylelenolic acid (3,4-DHPEA-EA) and 3,4-dihydroxyphenyielenolic acid dialdehyde (3,4-DHPEA-EDA) towards oxidation initiated by 2,2'-azobis (2-amidinopropane) hydrochloride in a soybean phospholipid liposome system was studied. The antioxidant activity of these olive oil phenols was similar and the duration of the lag phase was almost twice that of alpha-tocopherol. Trolox(R), a water-soluble analogue of alpha-tocopherol, showed the worst antioxidant activity. However, oxidation before the end of the lag phase was inhibited less effectively by the olive oil phenols than by alpha-tocopherol and Trolox(R). Synergistic effects (11-20% increase in lag phase) were observed in the antioxidant activity of combinations of alpha-tocopherol with olive oil phenols both with and without ascorbic acid. Fluorescence anisotropy of probes and fluorescence quenching studies showed that the olive oil phenols did not penetrate into the membrane, but their effectiveness as antioxidants showed they were associated with the surface of the phospholipid bilayer. (C) 2003 Elsevier Science Ireland Ltd. All rights reserved.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Fluorescence is a troublesome side effect in laboratory Raman studies on sulfuric acid solutions and aerosol particles. We performed experiments showing that organic matter induces fluorescence in H2SO4/H2O solutions. The intensity of the fluorescence signal appears to be almost independent of the concentration of the organic substances, but depends strongly on the sulfuric acid concentration. The ubiquity of organic substances in the atmosphere, their relatively high abundance, and the insensitivity of the fluorescence with respect to their concentrations will render most acidic natural aerosols subject to absorption and fluorescence, possibly influencing climate forcing. We show that, while fluorescence may in the future become a valuable tool of aerosol diagnostics, the concurrent absorption is too small to significantly affect the atmosphere's radiative balance.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The recent G8 Gleneagles climate statement signed on 8 July 2005 specifically mentions a determination to lessen the impact of aviation on climate [Gleneagles, 2005. The Gleneagles communique: climate change, energy and sustainable development. http://www.fco.gov.uk/Files/kfile/PostG8_Gleneagles_Communique.pdf]. In January 2005 the European Union Emission Trading Scheme (ETS) commenced operation as the largest multi-country, multi-sector ETS in the world, albeit currently limited only to CO2 emissions. At present the scheme makes no provision for aircraft emissions. However, the UK Government would like to see aircraft included in the ETS and plans to use its Presidencies of both the EU and G8 in 2005 to implement these schemes within the EU and perhaps internationally. Non-CO2 effects have been included in some policy-orientated studies of the impact of aviation but we argue that the inclusion of such effects in any such ETS scheme is premature; we specifically argue that use of the Radiative Forcing Index for comparing emissions from different sources is inappropriate and that there is currently no metric for such a purpose that is likely to enable their inclusion in the near future. (c) 2005 Elsevier Ltd. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Single crystal X-ray diffraction studies reveal that three hexapeptides with general formula Boc-Ile-Aib-Xx-Ile-Aib-Yy-OMe, where Xx and Yy are Leu in peptide I, Len and Phe in peptide II, and Phe and Leu in peptide III, respectively, adopt equivalent conformations that can be described as mixed 3(10)/alpha-helice with two 4 -> 1 and two 5 -> 1 intramolecular N-H center dot center dot center dot O=C H-bonds. The peptides do not generate any helixterminating Schellman motif despite having Aib at the penultimate position from C-terminus. In the crystalline state, the helices are packed in head-to-tail fashion through intermolecular hydrogen bonds to create supramolecular helical structures. The CD Studies of the three hexapeptides in acetonitrile indicate that they are folded in well-developed 3(10)-helical structures. NMR studies of peptide I in CDCl3 also suggest the formation of a homogeneous 3 m-helical structure. The field emission scanning electron microscopic (FE-SEM) images of peptide 11 in the solid state reveal a non-twisted ribbon-like morphology, which is formed through lateral association of non-twisted filaments. (c) 2007 Elsevier Ltd. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Three promising variants of autofluorescent proteins have been analyzed photophysically for their proposed use in single-molecule microscopy studies in living cells to compare their superiority to other fluorescent proteins previously reported regarding the number of photons emitted. The first variant under investigation the F46L mutant of eYFP has a 10% greater photon emission rate and > 50% slower photobleaching rate on average than the standard eYFP fluorophore. The monomeric red fluorescent protein (mRFP) has a fivefold lower photon emission rate, likely due to the monomeric content, and also a tenfold faster photobleaching rate than the DsRed fluorescent protein. In contrast, the previously reported eqfp611 has a 50% lower emission rate yet photobleaches more than a factor 2 slowly. We conclude that the F46L YFP and the eqfp611 are superior new options for single molecule imaging and tracking studies in living cells. Studies were also performed on the effects of forced quenching of multiple fluorescent proteins in sub-micrometer regions that would show the effects of dimerization at low concentration levels of fluorescent proteins and also indicate corrections to stoichiometry patterns with fluorescent proteins previously in print. We also introduce properties at the single molecule level of new FRET pairs with combinations of fluorescent proteins and artificial fluorophores.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The North Atlantic Marine Boundary Layer Experiment (NAMBLEX), involving over 50 scientists from 12 institutions, took place at Mace Head, Ireland (53.32° N, 9.90° W), between 23 July and 4 September 2002. A wide range of state-of-the-art instrumentation enabled detailed measurements of the boundary layer structure and atmospheric composition in the gas and aerosol phase to be made, providing one of the most comprehensive in situ studies of the marine boundary layer to date. This overview paper describes the aims of the NAMBLEX project in the context of previous field campaigns in the Marine Boundary Layer (MBL), the overall layout of the site, a summary of the instrumentation deployed, the temporal coverage of the measurement data, and the numerical models used to interpret the field data. Measurements of some trace species were made for the first time during the campaign, which was characterised by predominantly clean air of marine origin, but more polluted air with higher levels of NOx originating from continental regions was also experienced. This paper provides a summary of the meteorological measurements and Planetary Boundary Layer (PBL) structure measurements, presents time series of some of the longer-lived trace species (O3, CO, H2, DMS, CH4, NMHC, NOx, NOy, PAN) and summarises measurements of other species that are described in more detail in other papers within this special issue, namely oxygenated VOCs, HCHO, peroxides, organo-halogenated species, a range of shorter lived halogen species (I2, OIO, IO, BrO), NO3 radicals, photolysis frequencies, the free radicals OH, HO2 and (HO2+Σ RO2), as well as a summary of the aerosol measurements. NAMBLEX was supported by measurements made in the vicinity of Mace Head using the NERC Dornier-228 aircraft. Using ECMWF wind-fields, calculations were made of the air-mass trajectories arriving at Mace Head during NAMBLEX, and were analysed together with both meteorological and trace-gas measurements. In this paper a chemical climatology for the duration of the campaign is presented to interpret the distribution of air-mass origins and emission sources, and to provide a convenient framework of air-mass classification that is used by other papers in this issue for the interpretation of observed variability in levels of trace gases and aerosols.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Earth's climate is undoubtedly changing; however, the time scale, consequences and causal attribution remain the subject of significant debate and uncertainty. Detection of subtle indicators from a background of natural variability requires measurements over a time base of decades. This places severe demands on the instrumentation used, requiring measurements of sufficient accuracy and sensitivity that can allow reliable judgements to be made decades apart. The International System of Units (SI) and the network of National Metrology Institutes were developed to address such requirements. However, ensuring and maintaining SI traceability of sufficient accuracy in instruments orbiting the Earth presents a significant new challenge to the metrology community. This paper highlights some key measurands and applications driving the uncertainty demand of the climate community in the solar reflective domain, e.g. solar irradiances and reflectances/radiances of the Earth. It discusses how meeting these uncertainties facilitate significant improvement in the forecasting abilities of climate models. After discussing the current state of the art, it describes a new satellite mission, called TRUTHS, which enables, for the first time, high-accuracy SI traceability to be established in orbit. The direct use of a ‘primary standard’ and replication of the terrestrial traceability chain extends the SI into space, in effect realizing a ‘metrology laboratory in space’.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Attempts to estimate photosynthetic rate or gross primary productivity from remotely sensed absorbed solar radiation depend on knowledge of the light use efficiency (LUE). Early models assumed LUE to be constant, but now most researchers try to adjust it for variations in temperature and moisture stress. However, more exact methods are now required. Hyperspectral remote sensing offers the possibility of sensing the changes in the xanthophyll cycle, which is closely coupled to photosynthesis. Several studies have shown that an index (the photochemical reflectance index) based on the reflectance at 531 nm is strongly correlated with the LUE over hours, days and months. A second hyperspectral approach relies on the remote detection of fluorescence, which is a directly related to the efficiency of photosynthesis. We discuss the state of the art of the two approaches. Both have been demonstrated to be effective, but we specify seven conditions required before the methods can become operational.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We use new neutron scattering instrumentation to follow in a single quantitative time-resolving experiment, the three key scales of structural development which accompany the crystallisation of synthetic polymers. These length scales span 3 orders of magnitude of the scattering vector. The study of polymer crystallisation dates back to the pioneering experiments of Keller and others who discovered the chain-folded nature of the thin lamellae crystals which are normally found in synthetic polymers. The inherent connectivity of polymers makes their crystallisation a multiscale transformation. Much understanding has developed over the intervening fifty years but the process has remained something of a mystery. There are three key length scales. The chain folded lamellar thickness is ~ 10nm, the crystal unit cell is ~ 1nm and the detail of the chain conformation is ~ 0.1nm. In previous work these length scales have been addressed using different instrumention or were coupled using compromised geometries. More recently researchers have attempted to exploit coupled time-resolved small-angle and wide-angle x-ray experiments. These turned out to be challenging experiments much related to the challenge of placing the scattering intensity on an absolute scale. However, they did stimulate the possibility of new phenomena in the very early stages of crystallisation. Although there is now considerable doubt on such experiments, they drew attention to the basic question as to the process of crystallisation in long chain molecules. We have used NIMROD on the second target station at ISIS to follow all three length scales in a time-resolving manner for poly(e-caprolactone). The technique can provide a single set of data from 0.01 to 100Å-1 on the same vertical scale. We present the results using a multiple scale model of the crystallisation process in polymers to analyse the results.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We have incorporated a semi-mechanistic isoprene emission module into the JULES land-surface scheme, as a first step towards a modelling tool that can be applied for studies of vegetation – atmospheric chemistry interactions, including chemistry-climate feedbacks. Here, we evaluate the coupled model against local above-canopy isoprene emission flux measurements from six flux tower sites as well as satellite-derived estimates of isoprene emission over tropical South America and east and south Asia. The model simulates diurnal variability well: correlation coefficients are significant (at the 95 % level) for all flux tower sites. The model reproduces day-to-day variability with significant correlations (at the 95 % confidence level) at four of the six flux tower sites. At the UMBS site, a complete set of seasonal observations is available for two years (2000 and 2002). The model reproduces the seasonal pattern of emission during 2002, but does less well in the year 2000. The model overestimates observed emissions at all sites, which is partially because it does not include isoprene loss through the canopy. Comparison with the satellite-derived isoprene-emission estimates suggests that the model simulates the main spatial patterns, seasonal and inter-annual variability over tropical regions. The model yields a global annual isoprene emission of 535 ± 9 TgC yr−1 during the 1990s, 78 % of which from forested areas.