45 resultados para Instrumentation and orchestration
em CentAUR: Central Archive University of Reading - UK
Resumo:
During the interval between 8:00-9:30 on 14 January 2001, the four Cluster spacecraft were moving from the central magnetospheric lobe, through the dusk sector mantle, on their way towards intersecting the magnetopause near 15:00 MLT and 15:00 UT. Throughout this interval, the EIS-CAT Svalbard Radar (ESR) at Longyearbyen observed a series of poleward-moving transient events of enhanced F-region plasma concentration ("polar cap patches"), with a repetition period of the order of 10 min. Allowing for the estimated solar wind propagation delay of 75 ( 5) min, the interplanetary magnetic field (IMF) had a southward component during most of the interval. The magnetic footprint of the Cluster spacecraft, mapped to the ionosphere using the Tsyganenko T96 model (with input conditions prevailing during this event), was to the east of the ESR beams. Around 09:05 UT, the DMSP-F12 satellite flew over the ESR and showed a sawtooth cusp ion dispersion signature that also extended into the electrons on the equatorward edge of the cusp, revealing a pulsed magnetopause reconnection. The consequent enhanced ionospheric flow events were imaged by the SuperDARN HF backscatter radars. The average convection patterns (derived using the AMIE technique on data from the magnetometers, the EISCAT and SuperDARN radars, and the DMSP satellites) show that the associated poleward-moving events also convected over the predicted footprint of the Cluster spacecraft. Cluster observed enhancements in the fluxes of both electrons and ions. These events were found to be essentially identical at all four spacecraft, indicating that they had a much larger spatial scale than the satellite separation of the order of 600 km. Some of the events show a correspondence between the lowest energy magnetosheath electrons detected by the PEACE instrument on Cluster (10-20 eV) and the topside ionospheric enhancements seen by the ESR (at 400-700 km). We suggest that a potential barrier at the magnetopause, which prevents the lowest energy electrons from entering the magnetosphere, is reduced when and where the boundary-normal magnetic field is enhanced and that the observed polar cap patches are produced by the consequent enhanced precipitation of the lowest energy electrons, making them and the low energy electron precipitation fossil remnants of the magnetopause reconnection rate pulses.
Resumo:
Cooled infrared filters have been used in pressure modulation and filter radiometry to measure the dynamics, temperature distribution and concentrations of atmospheric elements in various satellite radiometers. Invariably such instruments use precision infrared bandpass filters and coatings for spectral selction, often operating at cryogenic temperatures. More recent developments in the use of spectrally-selective cooled detectors in focal plane arrays have simplified the optical layout and reduced the component count of radiometers but have placed additional demands on both the spectral and physical performance requirements of the filters. This paper describes and contrasts the more traditional radiometers using discrete detectors with those which use focal plane detector array technology, with particular emphasis on the function of the filters and coatings in the two cases. Additionally we discuss the spectral techniques and materials used to fabricate infrared coatings and filters for use in space optics, and give examples of their application in the fabrication of some demanding long wavelength dichroics and filters. We also discuss the effects of the space environment on the stability and durability of high performance infrared filters and materials exposed to low Earth orbit for 69 months on the NASA Long Duration Exposure Facility (LDEF).
Resumo:
In this article, we provide an initial insight into the study of MI and what it means for a machine to be intelligent. We discuss how MI has progressed to date and consider future scenarios in a realistic and logical way as much as possible. To do this, we unravel one of the major stumbling blocks to the study of MI, which is the field that has become widely known as "artificial intelligence"
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
Global climate change results from a small yet persistent imbalance between the amount of sunlight absorbed by Earth and the thermal radiation emitted back to space. An apparent inconsistency has been diagnosed between interannual variations in the net radiation imbalance inferred from satellite measurements and upper-ocean heating rate from in situ measurements, and this inconsistency has been interpreted as ‘missing energy’ in the system. Here we present a revised analysis of net radiation at the top of the atmosphere from satellite data, and we estimate ocean heat content, based on three independent sources. We find that the difference between the heat balance at the top of the atmosphere and upper-ocean heat content change is not statistically significant when accounting for observational uncertainties in ocean measurements, given transitions in instrumentation and sampling. Furthermore, variability in Earth’s energy imbalance relating to El Niño-Southern Oscillation is found to be consistent within observational uncertainties among the satellite measurements, a reanalysis model simulation and one of the ocean heat content records. We combine satellite data with ocean measurements to depths of 1,800 m, and show that between January 2001 and December 2010, Earth has been steadily accumulating energy at a rate of 0.50±0.43 Wm−2 (uncertainties at the 90% confidence level). We conclude that energy storage is continuing to increase in the sub-surface ocean.
Resumo:
In this paper we report coordinated multispacecraft and ground-based observations of a double substorm onset close to Scandinavia on November 17, 1996. The Wind and the Geotail spacecraft, which were located in the solar wind and the subsolar magnetosheath, respectively, recorded two periods of southward directed interplanetary magnetic field (IMF). These periods were separated by a short northward IMF excursion associated with a solar wind pressure pulse, which compressed the magnetosphere to such a degree that Geotail for a short period was located outside the bow shock. The first period of southward IMF initiated a substorm growth. phase, which was clearly detected by an array of ground-based instrumentation and by Interball in the northern tail lobe. A first substorm onset occurred in close relation to the solar wind pressure pulse impinging on the magnetopause and almost simultaneously with the northward turning of the IMF. However, this substorm did not fully develop. In clear association with the expansion of the magnetosphere at the end of the pressure pulse, the auroral expansion was stopped, and the northern sky cleared. We will present evidence that the change in the solar wind dynamic pressure actively quenched the energy available for any further substorm expansion. Directly after this period, the magnetometer network detected signatures of a renewed substorm growth phase, which was initiated by the second southward turning of the IMF and which finally lead to a second, and this time complete, substorm intensification. We have used our multipoint observations in order to understand the solar wind control of the substorm onset and substorm quenching. The relative timings between the observations on the various satellites and on the ground were used to infer a possible causal relationship between the solar wind pressure variations and consequent substorm development. Furthermore, using a relatively simple algorithm to model the tail lobe field and the total tail flux, we show that there indeed exists a close relationship between the relaxation of a solar wind pressure pulse, the reduction of the tail lobe field, and the quenching of the initial substorm.
Resumo:
Letter to the editor relates to article Warwick, K. and Nasuto, S.J (2006). 'Historical and Current Machine Intelligence.' IEEE Instrumentation and Measurement Magazine 9 (6):20-26.
Resumo:
An updated analysis of observed stratospheric temperature variability and trends is presented on the basis of satellite, radiosonde, and lidar observations. Satellite data include measurements from the series of NOAA operational instruments, including the Microwave Sounding Unit covering 1979–2007 and the Stratospheric Sounding Unit (SSU) covering 1979–2005. Radiosonde results are compared for six different data sets, incorporating a variety of homogeneity adjustments to account for changes in instrumentation and observational practices. Temperature changes in the lower stratosphere show cooling of 0.5 K/decade over much of the globe for 1979–2007, with some differences in detail among the different radiosonde and satellite data sets. Substantially larger cooling trends are observed in the Antarctic lower stratosphere during spring and summer, in association with development of the Antarctic ozone hole. Trends in the lower stratosphere derived from radiosonde data are also analyzed for a longer record (back to 1958); trends for the presatellite era (1958–1978) have a large range among the different homogenized data sets, implying large trend uncertainties. Trends in the middle and upper stratosphere have been derived from updated SSU data, taking into account changes in the SSU weighting functions due to observed atmospheric CO2 increases. The results show mean cooling of 0.5–1.5 K/decade during 1979–2005, with the greatest cooling in the upper stratosphere near 40–50 km. Temperature anomalies throughout the stratosphere were relatively constant during the decade 1995–2005. Long records of lidar temperature measurements at a few locations show reasonable agreement with SSU trends, although sampling uncertainties are large in the localized lidar measurements. Updated estimates of the solar cycle influence on stratospheric temperatures show a statistically significant signal in the tropics (30N–S), with an amplitude (solar maximum minus solar minimum) of 0.5 K (lower stratosphere) to 1.0 K (upper stratosphere).
Resumo:
A synthesis method is outlined for the design of broadband anti-reflection coatings for use in spaceborne infrared optics. The Golden Section optimisation routine is used to make a search, using designated non-absorptive dielectric thin film combinations, for the coating design which fulfils the required spectral requirements using the least number of layers and different materials. Three examples are given of coatings designed by this method : (I) 1µm to 12µm anti-reflection coating on Zinc Sulphide using Zinc Sulphide and Yttrium Fluoride thin film materials. (ii) 2µm to 14µm anti-reflection coating on Germanium using Germanium and Ytterbium Fluoride thin film materials. (iii) 6µm to 17µm anti-reflection coating on Germanium using Lead Telluride, Zinc Selenide and Barium Fluoride. The measured spectral performance of the manufactured 6µm to 17µm coating on Germanium is given. This is the anti-reflection coating for the germanium optics in the NASA Cassini Orbiter CIRS instrument.
Resumo:
The High Resolution Dynamics Limb Sounder is described, with particular reference to the atmospheric measurements to be made and the rationale behind the measurement strategy. The demands this strategy places on the filters to be used in the instrument and the designs to which this leads to are described. A second set of filters at an intermediate image plane to reduce "Ghost Imaging" is discussed together with their required spectral properties. A method of combining the spectral characteristics of the primary and secondary filters in each channel are combined together with the spectral response of the detectors and other optical elements to obtain the system spectral response weighted appropriately for the Planck function and atmospheric limb absorption. This method is used to demonstrate whether the out-of-band spectral blocking requirement for a channel is being met and an example calculation is demonstrated showing how the blocking is built up for a representative channel. Finally, the techniques used to produce filters of the necessary sub-millimetre sizes together with the testing methods and procedures used to assess the environmental durability and establish space flight quality are discussed.
Resumo:
A deterministic prototype video deghoster is presented which is capable of calculating all the multipath channel distortion characteristics in one single pass and subsequently removing the multipath distortions, commonly termed ghosts. Within the system, a channel identification algorithm finds in isolation all the ghost components while a dedicated DSP filter subsystem is capable of removing ghosts in real time. The results from the system are presented.
Resumo:
Abstract. Not long after Franklin’s iconic studies, an atmospheric electric field was discovered in “fair weather” regions, well away from thunderstorms. The origin of the fair weather field was sought by Lord Kelvin, through development of electrostatic instrumentation and early data logging techniques, but was ultimately explained through the global circuit model of C.T.R. Wilson. In Wilson’s model, charge exchanged by disturbed weather electrifies the ionosphere, and returns via a small vertical current density in fair weather regions. New insights into the relevance of fair weather atmospheric electricity to terrestrial and planetary atmospheres are now emerging. For example, there is a possible role of the global circuit current density in atmospheric processes, such as cloud formation. Beyond natural atmospheric processes, a novel practical application is the use of early atmospheric electrostatic investigations to provide quantitative information on past urban air pollution.