28 resultados para DNA structure
em CentAUR: Central Archive University of Reading - UK
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
We report the single-crystal X-ray structure for the complex of the bisacridine bis-(9-aminooctyl(2-(dimethylaminoethyl)acridine-4-carboxamide)) with the oligonucleotide d(CGTACG)2 to a resolution of 2.4 Å. Solution studies with closed circular DNA show this compound to be a bisintercalating threading agent, but so far we have no crystallographic or NMR structural data conforming to the model of contiguous intercalation within the same duplex. Here, with the hexameric duplex d(CGTACG), the DNA is observed to undergo a terminal cytosine base exchange to yield an unusual guanine quadruplex intercalation site through which the bisacridine threads its octamethylene linker to fuse two DNA duplexes. The 4-carboxamide side-chains form anchoring hydrogen-bonding interactions with guanine O6 atoms on each side of the quadruplex. This higher-order DNA structure provides insight into an unexpected property of bisintercalating threading agents, and suggests the idea of targeting such compounds specifically at four-way DNA junctions.
Resumo:
UV-generated excited states of cytosine (C) nucleobases are precursors to mutagenic photoproduct formation. The i-motif formed from C-rich sequences is known to exhibit high yields of long-lived excited states following UV absorption. Here the excited states of several i-motif structures have been characterized following 267 nm laser excitation using time-resolved infrared spectroscopy (TRIR). All structures possess a long-lived excited state of ~300 ps and notably in some cases decays greater than 1 ns are observed. These unusually long-lived lifetimes are attributed to the interdigitated DNA structure which prevents direct base stacking overlap.
Resumo:
Cedrus atlantica (Pinaceae) is a large and exceptionally long-lived conifer native to the Rif and Atlas Mountains of North Africa. To assess levels and patterns of genetic diversity of this species. samples were obtained throughout the natural range in Morocco and from a forest plantation in Arbucies, Girona (Spain) and analyzed using RAPD markers. Within-population genetic diversity was high and comparable to that revealed by isozymes. Managed populations harbored levels of genetic variation similar to those found in their natural counterparts. Genotypic analyses Of Molecular variance (AMOVA) found that most variation was within populations. but significant differentiation was also found between populations. particularly in Morocco. Bayesian estimates of F,, corroborated the AMOVA partitioning and provided evidence for Population differentiation in C. atlantica. Both distance- and Bayesian-based Clustering methods revealed that Moroccan populations comprise two genetically distinct groups. Within each group, estimates of population differentiation were close to those previously reported in other gymnosperms. These results are interpreted in the context of the postglacial history of the species and human impact. The high degree of among-group differentiation recorded here highlights the need for additional conservation measures for some Moroccan Populations of C. atlantica.
Resumo:
The role of metal ions in determining the solution conformation of the Holliday junction is well established, but to date the picture of metal ion binding from structural studies of the four-way DNA junction is very incomplete. Here we present two refined structures of the Holliday junction formed by the sequence d(TCGGTACCGA) in the presence of Na+ and Ca2+, and separately with Sr2+ to resolutions of 1.85 Angstrom and 1.65 Angstrom, respectively. This sequence includes the ACC core found to promote spontaneous junction formation, but its structure has not previously been reported. Almost complete hydration spheres can be defined for each metal cation. The Na+ sites, the most convincing observation of such sites in junctions to date, are one on either face of the junction crossover region, and stabilise the ordered hydration inside the junction arms. The four Ca2+ sites in the same structure are at the CG/CG steps in the minor groove. The Sr2+ ions occupy the TC/AG, GG/CC, and TA/TA sites in the minor groove, giving ten positions forming two spines of ions, spiralling through the minor grooves within each arm of the stacked-X structure. The two structures were solved in the two different C2 lattices previously observed, with the Sr2+ derivative crystallising in the more highly symmetrical form with two-fold symmetry at its centre. Both structures show an opening of the minor groove face of the junction of 8.4degrees in the Ca2+ and Na+ containing structure, and 13.4degrees in the Sr2+ containing structure. The crossover angles at the junction are 39.3degrees and 43.3degrees, respectively. In addition to this, a relative shift in the base pair stack alignment of the arms of 2.3 Angstrom is observed for the Sr2+ containing structure only. Overall these results provide an insight into the so-far elusive stabilising ion structure for the DNA Holliday junction. (C) 2003 Elsevier Science Ltd. All rights reserved.
Resumo:
We describe a crystal structure, at atomic resolution (1.1 Å, 100 K), of a ruthenium polypyridyl complex bound to duplex DNA, in which one ligand acts as a wedge in the minor groove, resulting in the 51° kinking of the double helix. The complex cation Λ-[Ru(1,4,5,8-tetraazaphenanthrene)2(dipyridophenazine)]2+ crystallizes in a 1∶1 ratio with the oligonucleotide d(TCGGCGCCGA) in the presence of barium ions. Each complex binds to one duplex by intercalation of the dipyridophenazine ligand and also by semiintercalation of one of the orthogonal tetraazaphenanthrene ligands into a second symmetrically equivalent duplex. The result is noncovalent cross-linking and marked kinking of DNA.
Resumo:
A four-wavelength MAD experiment on a new brominated octanucleotide is reported here. d[ACGTACG(5-BrU)], C77H81BrN30O32P7, (DNA) = 2235, tetragonal, P43212 (No. 96), a = 43.597, c = 26.268 Å, V = 49927.5 Å3, Z = 8, T = 100 K, R = 10.91% for 4312 reflections between 15.0 and 1.46 Å resolution. The self-complementary brominated octanucleotide d[ACGTACG(5-BrU)]2 has been crystallized and data measured to 1.45 Å at both 293 K and a second crystal flash frozen at 100 K. The latter data collection was carried out to the same resolution at the four wavelengths 0.9344, 0.9216, 0.9208 and 0.9003 Å, around the Br K edge at 0.92 Å and the structure determined from a map derived from a MAD data analysis using pseudo-MIR methodology, as implemented in the program MLPHARE. This is one of the first successful MAD phasing experiments carried out at Sincrotrone Elettra in Trieste, Italy. The structure was refined using the data measured at 0.9003 Å, anisotropic temperature factors and the restrained least-squares refinement implemented in the program SHELX96, and the helical parameters are compared with those previously determined for the isomorphous d(ACGTACGT)2 analogue. The asymmetric unit consists of a single strand of octamer with 96 water molecules. No countercations were located. The A-DNA helix geometry obtained has been analysed using the CURVES program.
Resumo:
d(ACGTACGT), C78H84N30O32P7.20H2O, Mr (DNA) = 2170, tetragonal, P43212 (No 96), a = 42.845 (1), b = 42.845(1), c = 24.804 (1) Å, V = 45532.5 (2) Å3, z = 8,(MoK) = 0.71069 Å,µ(MoK) = 0.10 mm-1, T = 295 K, R = 0.18 for 1994 unique reflections between 5.0 and 1.9 Å resolution. The self-complementary octanucleotide d(ACGTACGT)2 has been crystallized and its structure determined to a resolution of 1.9 Å. The asymmetric unit consists of a single strand of octamer with 20 water molecules. It is only the second example of an octanucleotide having terminal A·T base pairs whose structure has been determined by X-ray crystallography. The sequence adopts the modified A-type conformation found for all octanucleotide duplexes studied to date with the helix bent by approximately 15° and an average tilt angle of 0°. Unusually the data collection was carried out using a 3 kW molybdenum sealed-tube source. The conformational details are discussed in comparison with other closely related sequences.
Resumo:
The reaction of cis-[RuCl2(dmso)(4)] with [6-(2-pyridinyl)-5,6-dihydrobenzimidazo[1,2-c] quinazoline] (L) afforded in pure form a blue ruthenium(II) complex, [Ru(L-1)(2)] (1), where the original L changed to [2-(1H-benzoimidazol-2-yl)-phenyl]-pyridin-2-ylmethylene-amine (HL1). Treatment of RuCl3 center dot 3H(2)O with L in dry tetrahydrofuran in inert atmosphere led to a green ruthenium(II) complex, trans-[RuCl2(L-2)(2)] (2), where L was oxidized in situ to the neutral species 6-pyridin-yl-benzo[4,5]imidazo[1,2-c] quinazoline (L-2). Complex 2 was also obtained from the reaction of RuCl3 center dot 3H(2)O with L-2 in dry ethanol. Complexes 1 and 2 have been characterized by physico-chemical and spectroscopic tools, and 1 has been structurally characterized by single-crystal X-ray crystallography. The electrochemical behavior of the complexes shows the Ru(III)/Ru(II) couple at different potentials with quasi-reversible voltammograms. The interaction of these complexes with calf thymus DNA by using absorption and emission spectral studies allowed determination of the binding constant K-b and the linear Stern-Volmer quenching constant K-SV
Resumo:
To determine the effects of defoliation on microbial community structure, rhizosphere soil samples were taken pre-, and post-defoliation from the root tip and mature root regions of Trifolium repens L. and Lolium perenne L. Microbial DNA isolated from samples was used to generate polymerase chain reaction-denaturing gradient gel electrophoresis molecular profiles of bacterial and fungal communities. Bacterial plate counts were also obtained. Neither plant species nor defoliation affected the bacterial and fungal community structures in both the root tip and mature root regions, but there were significant differences in the bacterial and fungal community profiles between the two root regions for each plant. Prior to defoliation, there was no difference between plants for bacterial plate counts of soils from the root tip regions; however, counts were greater in the mature root region of L. perenne than T. repens. Bacterial plate counts for T. repens were higher in the root tip than the mature root region. After defoliation, there was no effect of plant type, position along the root or defoliation status on bacterial plate counts, although there were significant increases in bacterial plate counts with time. The results indicate that a general effect existed during maturation in the root regions of each plant, which had a greater impact on microbial community structure than either plant type or the effect of defoliation. In addition there were no generic consequences with regard to microbial populations in the rhizosphere as a response to plant defoliation.
Resumo:
The wild common bean (Phaseolus vulgaris) is widely but discontinuously distributed from northern Mexico to northern Argentina on both sides of the Isthmus of Panama. Little is known on how the species has reached its current disjunct distribution. In this research, chloroplast DNA polymorphisms in seven non-coding regions were used to study the history of migration of wild P. vulgaris between Mesoamerica and South America. A penalized likelihood analysis was applied to previously published Leguminosae ITS data to estimate divergence times between P. vulgaris and its sister taxa from Mesoamerica, and divergence times of populations within P. vulgaris. Fourteen chloroplast haplotypes were identified by PCR-RFLP and their geographical associations were studied by means of a Nested Clade Analysis and Mantel Tests. The results suggest that the haplotypes are not randomly distributed but occupy discrete parts of the geographic range of the species. The current distribution of haplotypes may be explained by isolation by distance and by at least two migration events between Mesoamerica and South America: one from Mesoamerica to South America and another one from northern South America to Mesoamerica. Age estimates place the divergence of P. vulgaris from its sister taxa from Mesoamerica at or before 1.3 Ma, and divergence of populations from Ecuador-northern Peru at or before 0.6 Ma. As these ages are taken as minimum divergence times, the influence of past events, such as the closure of the Isthmus of Panama and the final uplift of the Andes, on the migration history and population structure of this species cannot be disregarded.
Resumo:
Avian genomes are small and streamlined compared with those of other amniotes by virtue of having fewer repetitive elements and less non-coding DNA(1,2). This condition has been suggested to represent a key adaptation for flight in birds, by reducing the metabolic costs associated with having large genome and cell sizes(3,4). However, the evolution of genome architecture in birds, or any other lineage, is difficult to study because genomic information is often absent for long-extinct relatives. Here we use a novel bayesian comparative method to show that bone-cell size correlates well with genome size in extant vertebrates, and hence use this relationship to estimate the genome sizes of 31 species of extinct dinosaur, including several species of extinct birds. Our results indicate that the small genomes typically associated with avian flight evolved in the saurischian dinosaur lineage between 230 and 250 million years ago, long before this lineage gave rise to the first birds. By comparison, ornithischian dinosaurs are inferred to have had much larger genomes, which were probably typical for ancestral Dinosauria. Using comparative genomic data, we estimate that genome-wide interspersed mobile elements, a class of repetitive DNA, comprised 5 - 12% of the total genome size in the saurischian dinosaur lineage, but was 7 - 19% of total genome size in ornithischian dinosaurs, suggesting that repetitive elements became less active in the saurischian lineage. These genomic characteristics should be added to the list of attributes previously considered avian but now thought to have arisen in non-avian dinosaurs, such as feathers(5), pulmonary innovations 6, and parental care and nesting
Resumo:
We investigated the condensation of calf thymus DNA by amphiphilic polystyrene(m)-b-poly(l-lysine)(n) block copolymers (PSm-b- PLys(n), m, n = degree of polymerization), using small-angle X-ray scattering, polarized optical microscopy and laser scanning confocal microscopy. Microscopy studies showed that the DNA condenses in the form of fibrillar precipitates, with an irregular structure, due to electrostatic interactions between PLys and DNA. This is not modified by the presence of hydrophobic PS block. Scattering experiments show that the structure of the polyplexes corresponds to a local order of DNA rods which becomes more compact upon increasing n. It can be concluded that for DNA/ PSm-b- PLys(n) polyplexes, the balance between the PLys block length and the excess charge in the system plays an essential role in the formation of a liquid crystalline phase.