39 resultados para Crust of neutron stars
em CentAUR: Central Archive University of Reading - UK
Resumo:
The energy of the vh9/2 orbital in nuclei above N = 82 drops rapidly in energy relative to the vf7/2 orbital as the occupancy of the πh11/2 orbital increases. These two neutron orbitals become nearly degenerate as the proton drip line is approached. In this work, we have discovered the new nuclides 161Os and 157W, and studied the decays of the proton emitter 160Re in detail. The 161Os and 160Re nuclei were produced in reactions of 290, 300 and 310 MeV 58Ni ions with an isotopically enriched 106Cd target, separated in‐flight using the RITU separator and implanted into the GREAT spectrometer. The 161Os α a decays populated the new nuclide 157W, which decayed by β‐particle emission. The β decay fed the known α‐decaying 1/2+ and 11/2− states in 157Ta, which is consistent with a vf7/2 ground state in 157W. The measured α‐decay energy and half‐life for 161Os correspond to a reduced α‐decay width that is compatible with s‐wave α‐particle emission, implying that its ground state is also a vf7/2 state. Over 7000 160Re nuclei were produced and the γ decays of a new isomeric state feeding the πd3/2 level in 160Re were discovered, but no evidence for the proton or a decay of the expected πh11/2 state could be found. The isomer decays offer a natural explanation for this non‐observation and provides a striking example of the influence of the near degeneracy of the vh9/2 and vf7/2 orbitals on the properties of nuclei in this region.
Resumo:
Nickel cyanide is a layered material showing markedly anisotropic behaviour. High-pressure neutron diffraction measurements show that at pressures up to 20.1 kbar, compressibility is much higher in the direction perpendicular to the layers, c, than in the plane of the strongly chemically bonded metal-cyanide sheets. Detailed examination of the behaviour of the tetragonal lattice parameters, a and c, as a function of pressure reveal regions in which large changes in slope occur, for example, in c(P) at 1 kbar. The experimental pressure dependence of the volume data is fitted to a bulk modulus, B0, of 1050 (20) kbar over the pressure range 0–1 kbar, and to 124 (2) kbar over the range 1–20.1 kbar. Raman spectroscopy measurements yield additional information on how the structure and bonding in the Ni(CN)2 layers change with pressure and show that a phase change occurs at about 1 kbar. The new high-pressure phase, (Phase PII), has ordered cyanide groups with sheets of D4h symmetry containing Ni(CN)4 and Ni(NC)4 groups. The Raman spectrum of phase PII closely resembles that of the related layered compound, Cu1/2Ni1/2(CN)2, which has previously been shown to contain ordered C≡N groups. The phase change, PI to PII, is also observed in inelastic neutron scattering studies which show significant changes occurring in the phonon spectra as the pressure is raised from 0.3 to 1.5 kbar. These changes reflect the large reduction in the interlayer spacing which occurs as Phase PI transforms to Phase PII and the consequent increase in difficulty for out-of-plane atomic motions. Unlike other cyanide materials e.g. Zn(CN)2 and Ag3Co(CN)6, which show an amorphization and/or a decomposition at much lower pressures (~100 kbar), Ni(CN)2 can be recovered after pressurising to 200 kbar, albeit in a more ordered form.
Resumo:
The combined application of neutron reflectometry (NR) and ellipsometry to determine the oxidation kinetics of organic monolayers at the air–water interface is described for the first time. This advance was possible thanks to a new miniaturised reaction chamber that is compatible with the two techniques and has controlled gas delivery. The rate coefficient for the oxidation of methyl oleate monolayers by gas-phase O3 determined using NR is (5.4 ± 0.6) × 10−10 cm2 per molecule per s, which is consistent with the value reported in the literature but is now better constrained. This highlights the potential for the investigation of faster atmospheric reactions in future studies. The rate coefficient determined using ellipsometry is (5.0 ± 0.9) × 10−10 cm2 per molecule per s, which indicates the potential of this more economical, laboratory-based technique to be employed in parallel with NR. In this case, temporal fluctuations in the optical signal are attributed to the mobility of islands of reaction products. We outline how such information may provide critical missing information in the identification of transient reaction products in a range of atmospheric surface reactions in the future.
Resumo:
The structure of gold cyanide, AuCN, has been determined at 10 and 300 K using total neutron diffraction. The structure consists of infinite -Au-(CN)-Au-(CN)-Au-(CN)- linear chains, hexagonally packed, with the gold atoms in sheets. The Au-C and Au-N bond lengths are found to be identical, with d(Au-C/N) = 1.9703(5) Angstrom at 300 K. This work supersedes a previous study, by others, which used Rietveld analysis of neutron Bragg diffraction in isolation, and found these bonds to have significantly different lengths (Deltad = 0.24 Angstrom) at 300 K. The total correlation function, T(r), at 10 and 300 K, has been modeled using information derived from total diffraction. The broadening of inter- and intrachain correlations differs markedly due to random displacements of the chains in the direction of the chain axes. This is a consequence of the relatively weak bonding between the chains. An explanation for the negative thermal expansion in the c-direction, which occurs between 10 and 300 K, is presented.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
An efficient method of combining neutron diffraction data over an extended Q range with detailed atomistic models is presented. A quantitative and qualitative mapping of the organization of the chain conformation in both glass and liquid phase has been performed. The proposed structural refinement method is based on the exploitation of the intrachain features of the diffraction pattern by the use of internal coordinates for bond lengths, valence angles and torsion rotations. Models are built stochastically by assignment of these internal coordinates from probability distributions with limited variable parameters. Variation of these parameters is used in the construction of models that minimize the differences between the observed and calculated structure factors. A series of neutron scattering data of 1,4-polybutadiene at the region 20320 K is presented. Analysis of the experimental data yield bond lengths for C-C and C=C of 1.54 and 1.35 Å respectively. Valence angles of the backbone were found to be at 112 and 122.8 for the CCC and CC=C respectively. Three torsion angles corresponding to the double bond and the adjacent R and β bonds were found to occupy cis and trans, s(, trans and g( and trans states, respectively. We compare our results with theoretical predictions, computer simulations, RIS models, and previously reported experimental results.
Resumo:
The lattice parameters extracted from Lebail analysis of neutron powder diffraction data collected between 2 and 300 K have been used to calculate the temperature evolution of the thermal expansion tensor for hopeite, Zn-3(PO4)(2)center dot 2H(2)O, Pnma,Z=4with a= 10.6065(4) angstrom, b = 18.2977(4) angstrom, c= 5.0257(2) A at 275 K. The a lattice parameter shows a negative thermal expansion, the b lattice parameter appears to saturate at 275 K while the c lattice parameter has a more typical positive thermal expansion. At 275 K, the magnitudes of the thermal expansion coefficients are alpha(a) = -1. 1(4) x 10(-5) K-1, alpha(b) = 2.4(9) x 10(-6) K-1 and alpha(c) = 3.6(2) x 10(-1) K-1. Under the conditions of these experiments, hopeite begins to dehydrate to the dihydrate between 300 and 325 K, and between 480 and 500 K the monohydrate is formed. The thermal expansion of the dihydrate has been calculated between 335 and 480 and at 480 K the magnitudes of the thermal expansion coefficients are alpha(a) = 1(2) x 10(-5) K-1, alpha(b) = 4(l) x 10(-6) K-1, alpha(c) = 4(2) x 10(-5) K-1, alpha(beta) = 1 (1) x 10(-1) K-1, and alpha(v) = 2(2) x 10(-1) K-1. The thermal expansion of hopeite is described in terms of its crystal structure and possible dehydration mechanisms for the alpha and beta modifications of hopeite are discussed.
Resumo:
The surfactant properties of aqueous protein mixtures ( ranaspumins) from the foam nests of the tropical frog Physalaemus pustulosus have been investigated by surface tension, two-photon excitation. uorescence microscopy, specular neutron reflection, and related biophysical techniques. Ranaspumins lower the surface tension of water more rapidly and more effectively than standard globular proteins under similar conditions. Two- photon excitation. uorescence microscopy of nest foams treated with fluorescent marker ( anilinonaphthalene sulfonic acid) shows partitioning of hydrophobic proteins into the air-water interface and allows imaging of the foam structure. The surface excess of the adsorbed protein layers, determined from measurements of neutron reflection from the surface of water utilizing H2O/D2O mixtures, shows a persistent increase of surface excess and layer thickness with bulk concentration. At the highest concentration studied ( 0.5 mg ml(-1)), the adsorbed layer is characterized by three distinct regions: a protruding top layer of similar to20 Angstrom, a middle layer of similar to30 Angstrom, and a more diffuse submerged layer projecting some 25 Angstrom into bulk solution. This suggests a model involving self-assembly of protein aggregates at the air-water interface in which initial foam formation is facilitated by specific surfactant proteins in the mixture, further stabilized by subsequent aggregation and cross-linking into a multilayer surface complex.
Resumo:
The indolines and thionins are basic, amphiphilic and cysteine-rich proteins found in cereals; puroindoline-a (Pin-a) and β-purothionin (β-Pth) are members of these families in wheat (Triticum aestivum). Pin-a and β-Pth have been suggested to play a significant role in seed defence against microbial pathogens, making the interaction of these proteins with model bacterial membranes an area of potential interest. We have examined the binding of these proteins to lipid monolayers composed of 1,2-dipalmitoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DPPG) using a combination of neutron reflectometry, Brewster angle microscopy, and infrared spectroscopy. Results showed that both Pin-a and β-Pth interact strongly with condensed phase DPPG monolayers, but the degree of penetration was different. β-Pth was shown to penetrate the lipid acyl chain region of the monolayer and remove lipids from the air/liquid interface during the adsorption process, suggesting this protein may be able to both form membrane spanning ion channels and remove membrane phospholipids in its lytic activity. Conversely, Pin-a was shown to interact mainly with the head-group region of the condensed phase DPPG monolayer and form a 33 Å thick layer below the lipid film. The differences between the interfacial structures formed by these two proteins may be related to the differing composition of the Pin-a and β-Pth hydrophobic regions.
Resumo:
We model the thermal evolution of a subsurface ocean of aqueous ammonium sulfate inside Titan using a parameterized convection scheme. The cooling and crystallization of such an ocean depends on its heat flux balance, and is governed by the pressure-dependent melting temperatures at the top and bottom of the ocean. Using recent observations and previous experimental data, we present a nominal model which predicts the thickness of the ocean throughout the evolution of Titan; after 4.5 Ga we expect an aqueous ammonium sulfate ocean 56 km thick, overlain by a thick (176 km) heterogeneous crust of methane clathrate, ice I and ammonium sulfate. Underplating of the crust by ice I will give rise to compositional diapirs that are capable of rising through the crust and providing a mechanism for cryovolcanism at the surface. We have conducted a parameter space survey to account for possible variations in the nominal model, and find that for a wide range of plausible conditions, an ocean of aqueous ammonium sulfate can survive to the present day, which is consistent with the recent observations of Titan's spin state from Cassini radar data [Lorenz, R.D., Stiles, B.W., Kirk, R.L., Allison, M.D., del Marmo, P.P., Iess, L., Lunine, J.I., Ostro, S.J., Hensley, S., 2008. Science 319, 1649–1651].
Resumo:
What is it that gives celebrities the voice and authority to do and say the things they do in the realm of development politics? Asked another way, how is celebrity practised and, simultaneously, how does this praxis make celebrity, personas, politics and, indeed, celebrities themselves? In this article, we explore this ‘celebrity praxis’ through the lens of the creation of the contemporary ‘development celebrity’ in those stars working for development writ large in the so-called Third World. Drawing on work in science studies, material cultures and the growing geo-socio-anthropologies of things, the key to understanding the material practices embedded in and creating development celebrity networks is the multiple and complex circulations of the everyday and bespectacled artefacts of celebrity. Conceptualised as the ‘celebrity–consumption–compassion complex’, the performances of development celebrities are as much about everyday events, materials, technologies, emotions and consumer acts as they are about the mediated and liquidised constructions of the stars who now ‘market’ development.Moreover, this complex is constructed by and constructs what we are calling ‘star/poverty space’ that works to facilitate the ‘expertise’ and ‘authenticity’ and, thus, elevated voice and authority, of development celebrities through poverty tours, photoshoots, textual and visual diaries, websites and tweets. In short, the creation of star/poverty space is performed through a kind of ‘materiality of authenticity’ that is at the centre of the networks of development celebrity. The article concludes with several brief observations about the politics, possibilities and problematics of development celebrities and the star/poverty spaces that they create.
Resumo:
We present an efficient method of combining wide angle neutron scattering data with detailed atomistic models, allowing us to perform a quantitative and qualitative mapping of the organisation of the chain conformation in both glass and liquid phases. The structural refinement method presented in this work is based on the exploitation of the intrachain features of the diffraction pattern and its intimate linkage with atomistic models by the use of internal coordinates for bond lengths, valence angles and torsion rotations. Atomic connectivity is defined through these coordinates that are in turn assigned by pre-defined probability distributions, thus allowing for the models in question to be built stochastically. Incremental variation of these coordinates allows for the construction of models that minimise the differences between the observed and calculated structure factors. We present a series of neutron scattering data of 1,2 polybutadiene at the region 120-400K. Analysis of the experimental data yield bond lengths for C-C and C=C of 1.54Å and 1.35Å respectively. Valence angles of the backbone were found to be at 112° and the torsion distributions are characterised by five rotational states, a three-fold trans-skew± for the backbone and gauche± for the vinyl group. Rotational states of the vinyl group were found to be equally populated, indicating a largely atactic chan. The two backbone torsion angles exhibit different behaviour with respect to temperature of their trans population, with one of them adopting an almost all trans sequence. Consequently the resulting configuration leads to a rather persistent chain, something indicated by the value of the characteristic ratio extrapolated from the model. We compare our results with theoretical predictions, computer simulations, RIS models and previously reported experimental results.
Resumo:
The effect of the tensor component of the Skyrme effective nucleon-nucleon interaction on the single-particle structure in superheavy elements is studied. A selection of the available Skyrme forces has been chosen and their predictions for the proton and neutron shell closures investigated. The inclusion of the tensor term with realistic coupling strength parameters leads to a small increase in the spin-orbit splitting between the proton 2f7/2 and 2f5/2 partners, opening the Z=114 shell gap over a wide range of nuclei. The Z=126 shell gap, predicted by these models in the absence of the tensor term, is found to be stongly dependent on neutron number with a Z=138 gap opening for large neutron numbers, having a consequent implication for the synthesis of neutron-rich superheavy elements. The predicted neutron shell structures remain largely unchanged by inclusion of the tensor component.
Resumo:
This paper outlines some of the physics opportunities available with the GSI RISING active stopper and presents preliminary results from an experiment aimed at performing beta-delayed gamma-ray spectroscopic studies in heavy-neutron-rich nuclei produced following the projectile fragmentation of a 1 GeV per nucleon 208Pb primary beam. The energy response of the silicon active stopping detector for both heavy secondary fragments and beta-particles is demonstrated and preliminary results on the decays of neutron-rich Tantalum (Ta) to Tungsten (W) isotopes are presented as examples of the potential of this technique to allow new structural studies in hitherto experimentally unreachable heavy, neutron-rich nuclei. The resulting spectral information inferred from excited states in the tungsten daughter nuclei are compared with results from axially symmetric Hartree–Fock calculations of the nuclear shape and suggest a change in ground state structure for the N = 116 isotone 190W compared to the lighter isotopes of this element.