The role of weeds in supporting biological diversity within crop fields

Weeds are major constraints on crop production, yet as part of the primary producers within farming systems, they may be important components of the agroecosystem. Using published literature, the role of weeds in arable systems for other above-ground trophic levels are examined. In the UK, there is evidence that weed flora have changed over the past century, with some species declining in abundance, whereas others have increased. There is also some evidence for a decline in the size of arable weed seedbanks. Some of these changes reflect improved agricultural efficiency, changes to more winter-sown crops in arable rotations and the use of more broad-spectrum herbicide combinations. Interrogation of a database of records of phytophagous insects associated with plant species in the UK reveals that many arable weed species support a high diversity of insect species. Reductions in abundances of host plants may affect associated insects and other taxa. A number of insect groups and farmland birds have shown marked population declines over the past 30 years. Correlational studies indicate that many of these declines are associated with changes in agricultural practices. Certainly reductions in food availability in winter and for nestling birds in spring are implicated in the declines of several bird species, notably the grey partridge, Perdix perdix . Thus weeds have a role within agroecosystems in supporting biodiversity more generally. An understanding of weed competitivity and the importance of weeds for insects and birds may allow the identification of the most important weed species. This may form the first step in balancing the needs for weed control with the requirements for biodiversity and more sustainable production methods.

Cultural techniques for improvement in biocontrol potential of fungal antagonists for biological control of Armillaria root rot of strawberry plants under glasshouse conditions

Several in vitro and in vivo experiments were conducted to develop an effective technique for culturing potential fungal antagonists (isolates of Trichoderma harzianum, Dactylium dendroides, Chaetomium olivaceum and one unidentified fungus) selected for activity against Armillaria mellea. The antagonists were inoculated onto (1) live spawn of the oyster mu shroom (Pleurotus ostreatus), (2) extra-moistened or sucrose-enriched mushroom composts containing living or autoclaved mycelia of P. ostreatus or Agaricus bisporus (button mushroom), (3) pasteurized compost with or without A. bisporus mycelium, wheat bran, wheat germ and (4) spent mushroom composts with living mycelia of A. bisporus, P. ostreatus or Lentinus edodes (the Shiitake mushroom). In one experiment, a representative antagonist (isolate Th2 of T. harzianum) was grown together with the A. bisporus mycelium, while in another one, the antagonist was first grown on wheat germ or wheat bran and then on mushroom compost with living mycelium of A. bisporus. Some of the carrier substrates were then added to the roots of potted strawberry plants in the glasshouse to evaluate their effectiveness against the disease. The antagonists failed to grow on the spawn of P. ostreatus even after reinoculations and prolonged incubation. Providing extra moisture or sucrose enrichment also did not improve the growth of Th2 on mushroom composts in the presence of living mycelia of A. bisporus or P. ostreatus. The antagonist, however, grew rapidly and extensively on mushroom compost with autoclaved mycelia, and also on wheat germ and wheat bran. Colonization of the substrates by the antagonist was positively correlated with its effectiveness in the glasshouse studies. Whereas only 33.3% of the inoculated control plants survived in one experiment monitored for 560 days, 100% survival was achieved when Th2 was applied on wheat germ or wheat bran. Growth of the antagonist alone on pasteurized or sterilized compost (without A. bisporus mycelia) and simultaneous growth of the antagonist and mushroom on pasteurized compost did not improve survival over the inoculated controls, but growth over mushroom compost with the living mycelium resulted in 50% survival rate. C. olivaceum isolate Co was the most effective, resulting in overall survival rate of 83.3% compared with only 8.3% for the inoculated and 100% for the uninoculated (healthy) controls. This antagonist gave the highest survival rate of 100% on spent mushroom compost with L. edodes. T harzianum isolate Th23, with 75% survival rate, was the most effective on spent mushroom compost with P. ostreatus, while D. dendroides isolate SP resulted in equal survival rates of 50% on all the three mushroom composts.

Climate and biological control in organic crops

Organic farming has increased in popularity in recent years, primarily as a response to the perceived health and conservation benefits. While it is likely that conventional farming will be able to respond rapidly to variations in pest numbers and distribution resulting from climatic change, it is not clear if the same is true for organic farming. Few studies have looked at the responses of biological control organisms to climate change. Here, I review the direct and indirect eects of changes in temperature, atmospheric carbon dioxide and other climatic factors on the predators, parasitoids and pathogens of pest insects in temperate agriculture. Finally, I consider what research is needed to manage the anticipated change in pest insect dynamics and distributions.

Structural studies on acridine derivatives binding to telomeric DNA

Acridine derivatives can inhibit a variety of nuclear enzymes by binding or intercalating to DNA. This class of compounds is of great interest in the development of novel anticancer agents. Despite the availability of crystallographic data for some of the compounds complexed with DNA, uncertainties remain about the mechanisms of action, binding preferences and biological targets. To investigate the intercalation of several acridine derivatives, a variety of techniques are being employed. Single-crystal X-ray diffraction is being used to determine the high resolution three-dimensional structure of short sequences of quadruplex telomeric DNA with bound drug. This will be compared to the effect of drug binding to long segments of double-stranded DNA using fibre diffraction, with neutron diffraction studies planned to analyse the hydrogen bonding patterns of the DNA-drug complexes. Small-angle neutron scattering (SANS) will also be applied to study drug binding to both short and long sequences of quadruplex and double-stranded DNA in solution. Initial SANS measurements of the telomeric repeat d(TGGGGT) imply that this hexamer is present as a quadruplex. (c) 2006 Elsevier B.V. All rights reserved.

DNA cleavage and antitumour activity of platinum(II) and copper(II) compounds derived from 4-methyl-2-N-(2-pyridylmethyl)aminophenol: spectroscopic, electrochemical and biological investigation

The reaction of the redox-active ligand, Hpyramol (4-methyl-2-N-(2-pyridylmethyl)aminophenol) with K2PtCl4 yields monofunctional square-planar [Pt(pyrimol)Cl], PtL-Cl, which was structurally characterised by single-crystal X-ray diffraction and NMR spectroscopy. This compound unexpectedly cleaves supercoiled double-stranded DNA stoichiometrically and oxidatively, in a non-specific manner without any external reductant added, under physiological conditions. Spectro-electrochemical investigations of PtL-Cl were carried out in comparison with the analogue CuL-Cl as a reference compound. The results support a phenolate oxidation, generating a phenoxyl radical responsible for the ligand-based DNA cleavage property of the title compounds. Time-dependent in vitro cytotoxicity assays were performed with both PtL-Cl and CuL-Cl in various cancer cell lines. The compound CuL-Cl overcomes cisplatin-resistance in ovarian carcinoma and mouse leukaemia cell lines, with additional activity in some other cells. The platinum analogue, PtL-Cl also inhibits cell-proliferation selectively. Additionally, cellular-uptake studies performed for both compounds in ovarian carcinoma cell lines showed that significant amounts of Pt and Cu were accumulated in the A2780 and A2780R cancer cells. The conformational and structural changes induced by PtL-Cl and CuL-Cl on calf thymus DNA and phi X174 supercoiled phage DNA at ambient conditions were followed by electrophoretic mobility assay and circular dichroism spectroscopy. The compounds induce extensive DNA degradation and unwinding, along with formation of a monoadduct at the DNA minor groove. Thus, hybrid effects of metal-centre variation, multiple DNA-binding modes and ligand-based redox activity towards cancer cell-growth inhibition have been demonstrated. Finally, reactions of PtL-Cl with DNA model bases (9-Ethylguanine and 5'-GMP) followed by NMR and MS showed slow binding at Guanine-N7 and for the double stranded self complimentary oligonucleotide d(GTCGAC)(2) in the minor groove.

Predicting the thermal inactivation of bacteria in a solid matrix: simulation studies on the relative effects of microbial thermal resistance parameters and process conditions

A combined mathematical model for predicting heat penetration and microbial inactivation in a solid body heated by conduction was tested experimentally by inoculating agar cylinders with Salmonella typhimurium or Enterococcus faecium and heating in a water bath. Regions of growth where bacteria had survived after heating were measured by image analysis and compared with model predictions. Visualisation of the regions of growth was improved by incorporating chromogenic metabolic indicators into the agar. Preliminary tests established that the model performed satisfactorily with both test organisms and with cylinders of different diameter. The model was then used in simulation studies in which the parameters D, z, inoculum size, cylinder diameter and heating temperature were systematically varied. These simulations showed that the biological variables D, z and inoculum size had a relatively small effect on the time needed to eliminate bacteria at the cylinder axis in comparison with the physical variables heating temperature and cylinder diameter, which had a much greater relative effect. (c) 2005 Elsevier B.V All rights reserved.

Outthinking and enhancing biological brains

In this paper an attempt has been made to take a look at. how the use of implant and electrode technology can now be employed to create biological brains for robots, to enable human enhancement and to diminish the effects of certain neural illnesses. In all cases the end result is to increase the range of abilities of the recipients. An indication is given of a number of areas in which such technology has already had a profound effect, a key element being the need for a clear interface linking the human brain directly with a computer. An overview of some of the latest developments in the field of Brain to Computer Interfacing is also given in order to assess advantages and disadvantages. The emphasis is clearly placed on practical studies that have been and are being undertaken and reported on, as opposed to those speculated, simulated or proposed as future projects. Related areas are discussed briefly only in the context of their contribution to the studies being undertaken. The area of focus is notably the use of invasive implant technology, where a connection is made directly with the cerebral cortex and/or nervous system. Tests and experimentation which do not involve human subjects are invariably carried out a priori to indicate the eventual possibilities before human subjects are themselves involved. Some of the more pertinent animal studies from this area are discussed including our own involving neural growth. The paper goes on to describe human experimentation, in which neural implants have linked the human nervous system bi-directionally with technology and the internet. A view is taken as to the prospects for the future for this implantable computing in terms of both therapy and enhancement.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Using learning networks to understand complex systems: a case study of biological, geophysical and social research in the Amazon

Developing high-quality scientific research will be most effective if research communities with diverse skills and interests are able to share information and knowledge, are aware of the major challenges across disciplines, and can exploit economies of scale to provide robust answers and better inform policy. We evaluate opportunities and challenges facing the development of a more interactive research environment by developing an interdisciplinary synthesis of research on a single geographic region. We focus on the Amazon as it is of enormous regional and global environmental importance and faces a highly uncertain future. To take stock of existing knowledge and provide a framework for analysis we present a set of mini-reviews from fourteen different areas of research, encompassing taxonomy, biodiversity, biogeography, vegetation dynamics, landscape ecology, earth-atmosphere interactions, ecosystem processes, fire, deforestation dynamics, hydrology, hunting, conservation planning, livelihoods, and payments for ecosystem services. Each review highlights the current state of knowledge and identifies research priorities, including major challenges and opportunities. We show that while substantial progress is being made across many areas of scientific research, our understanding of specific issues is often dependent on knowledge from other disciplines. Accelerating the acquisition of reliable and contextualized knowledge about the fate of complex pristine and modified ecosystems is partly dependent on our ability to exploit economies of scale in shared resources and technical expertise, recognise and make explicit interconnections and feedbacks among sub-disciplines, increase the temporal and spatial scale of existing studies, and improve the dissemination of scientific findings to policy makers and society at large. Enhancing interaction among research efforts is vital if we are to make the most of limited funds and overcome the challenges posed by addressing large-scale interdisciplinary questions. Bringing together a diverse scientific community with a single geographic focus can help increase awareness of research questions both within and among disciplines, and reveal the opportunities that may exist for advancing acquisition of reliable knowledge. This approach could be useful for a variety of globally important scientific questions.

A process for analysis of microarray comparative genomics hybridisation studies for bacterial genomes

Background: Microarray based comparative genomic hybridisation (CGH) experiments have been used to study numerous biological problems including understanding genome plasticity in pathogenic bacteria. Typically such experiments produce large data sets that are difficult for biologists to handle. Although there are some programmes available for interpretation of bacterial transcriptomics data and CGH microarray data for looking at genetic stability in oncogenes, there are none specifically to understand the mosaic nature of bacterial genomes. Consequently a bottle neck still persists in accurate processing and mathematical analysis of these data. To address this shortfall we have produced a simple and robust CGH microarray data analysis process that may be automated in the future to understand bacterial genomic diversity. Results: The process involves five steps: cleaning, normalisation, estimating gene presence and absence or divergence, validation, and analysis of data from test against three reference strains simultaneously. Each stage of the process is described and we have compared a number of methods available for characterising bacterial genomic diversity, for calculating the cut-off between gene presence and absence or divergence, and shown that a simple dynamic approach using a kernel density estimator performed better than both established, as well as a more sophisticated mixture modelling technique. We have also shown that current methods commonly used for CGH microarray analysis in tumour and cancer cell lines are not appropriate for analysing our data. Conclusion: After carrying out the analysis and validation for three sequenced Escherichia coli strains, CGH microarray data from 19 E. coli O157 pathogenic test strains were used to demonstrate the benefits of applying this simple and robust process to CGH microarray studies using bacterial genomes.

Studies into the role of the SEF14 fimbrial antigen in the pathogenesis of Salmonella enteritidis

To investigate the role of the SEF14 fimbrial antigen in pathogenesis, a single defined sefA (SEF14(-)) inactivated mutant of Salmonella enteritidis strain LA5 was constructed and tested in a number of biological assay systems. There was no significant difference between the wild-type strain and the isogenic SEF14(-) mutant in their abilities to adhere to and invade HEp-2 epithelial cells or their survival in mouse peritoneal macrophages, whereas the SEF14(-) mutant was ingested more rapidly by isolated human PMN. Both the strains colonized the intestine, invaded and spread systemically in 1 day-old chicks, laying hens and BALB/c mice equally well. A significantly greater number of chicks excreted the wildtype SEF14(+) strain during the first week following infection as compared to those infected with the SEF14(-) mutant. However, similar numbers of chicks excreted the two strains between 2 and 7 weeks after infection. These results indicate that possession of SEF14 fimbriae alone do not appear to play a significant role in the pathogenesis of S. enteritidis although its contribution to virulence may be dependent on the host species infected. (C) 1996 Academic Press Limited

Markers for nutrition studies: review of criteria for the evaluation of markers

The following criteria were identified as essential elements in the evaluation of markers: (1) the marker has a causal biological link with the endpoint, (2) there is a significant association between marker and endpoint in the target population, (3) marker changes consistently with the endpoint, e.g., in response to an intervention, and (4) change in the marker explains a substantial proportion of the change in the endpoint in response to the intervention.

Beyond arousal and valence: the importance of the biological versus social relevance of emotional stimuli

The present study addressed the hypothesis that emotional stimuli relevant to survival or reproduction (biologically emotional stimuli) automatically affect cognitive processing (e.g., attention, memory), while those relevant to social life (socially emotional stimuli) require elaborative processing to modulate attention and memory. Results of our behavioral studies showed that (1) biologically emotional images hold attention more strongly than do socially emotional images, (2) memory for biologically emotional images was enhanced even with limited cognitive resources, but (3) memory for socially emotional images was enhanced only when people had sufficient cognitive resources at encoding. Neither images’ subjective arousal nor their valence modulated these patterns. A subsequent functional magnetic resonance imaging study revealed that biologically emotional images induced stronger activity in the visual cortex and greater functional connectivity between the amygdala and visual cortex than did socially emotional images. These results suggest that the interconnection between the amygdala and visual cortex supports enhanced attention allocation to biological stimuli. In contrast, socially emotional images evoked greater activity in the medial prefrontal cortex (MPFC) and yielded stronger functional connectivity between the amygdala and MPFC than did biological images. Thus, it appears that emotional processing of social stimuli involves elaborative processing requiring frontal lobe activity.

Biological significance of short-chain fatty acid metabolism by the intestinal microbiome

Purpose of review Evidence suggests that short-chain fatty acids (SCFAs) derived from microbial metabolism in the gut play a central role in host homeostasis. The present review describes the current understanding and physiological implications of SCFAs derived from microbial metabolism of nondigestible carbohydrates. Recent findings Recent studies indicate a role for SCFAs, in particular propionate and butyrate, in the metabolic and inflammatory disorders such as obesity, diabetes and inflammatory bowel diseases, through the activation of specific G-protein-coupled receptors and modification of transcription factors. Established prebiotics, such as fructooligosaccharides and galactooligosaccharides, which support the growth of Bifidobacteria, mainly mediate acetate production. Thus, recent identification of prebiotics which are able to stimulate the production of propionate and butyrate by benign saccharolytic populations in the colon is of interest. Summary Manipulation of saccharolytic fermentation by prebiotic substrates is beginning to provide information on structure–function relationships relating to the production of SCFAs, which have multiple roles in host homeostasis.

Sialic acids in biological and therapeutic processes: opportunities and challenges

It is now well documented that carbohydrates play multiple roles in biological processes, and hence are interesting targets for chemical biology and medicinal chemistry programmes. This review focuses on a subset of carbohydrates, specifically sialic acid containing carbohydrates. It highlights their occurrence and diversity, and presents evidence for their roles in a range of biological pathways. It illustrates that they are targets for novel medicinal chemistry strategies for a range of therapeutic areas, including cancer and immunity. Case studies highlight opportunities and challenges in this area, and sialic acid based drugs that have entered clinical practice, and are promising candidates for future disease intervention schemes, are discussed. The review concludes by highlighting perspectives and emerging roles for these targets.