90 resultados para Biological Studies of Copper
em CentAUR: Central Archive University of Reading - UK
Resumo:
The synthesis. crystal structure and thermal study of the blue catena-(L-glutamato)-aqua copper(II) monohydrate have been reported. The compound crystallizes in P2(1)2(1)2(1) space group and consists of a polymeric three-dimensional network of copper(II) which is coordinated with the amino nitrogen and the carboxylate oxygen Of L-glutamate, the side chain carboxylate oxygen of a neighbouring L-glutamate and the oxygen of a water molecule in the equatorial position. Weak coordination of two additional glutamate oxygen atoms to both the axial positions Completes a distorted octahedron. The crystal structure shows that the lattice water is stabilized by the formation of strong H-bonding network with the coordinated water molecule. Removal and reabsorption of the water molecule have been studied by thermal analysis.
Resumo:
The IR and ligand field spectra and the structure of the mixed-ligand compound [N,N-dimethyl-N′-ethyl-1,2-diaminoethane(1-phenyl-1,3-butanedionato)(perchlorato)copper(II)]), [Cu(dmeen)bzac(OClO3)], are reported. The structure was determined by single crystal X-ray diffraction analysis (triclinic, space group ). The structure is square pyramidal with the apical position occupied by one oxygen of the tetrahedral perchlorato group (distance from copper 2.452(5) Å). The plane of the phenyl ring is tilted forming an angle of 16.72(14)° with the plane of the β-dionato moiety. The nitrogenous base adopts the gauche conformation with torsional angle of 108.72(14)°. The ethyl group is cis oriented relative to the phenyl group, occupying the equatorial position with the vector of the carbon-nitrogen bond forming an angle of 143.9(3)° with the CuNN plane. The interactions of the adjacent axial hydrogen with an oxygen of the perchlorato group result in hydrogen bond formation. The IR spectra reveal that in the solid state the Br− or Cl− displace easily the ClO4− group. The shifts in the ligand field spectra indicate that polar solvents participate in donor-acceptor interactions with the metal centre along an axis perpendicular to the CuN2O2 plane.
Resumo:
Several in vitro and in vivo experiments were conducted to develop an effective technique for culturing potential fungal antagonists (isolates of Trichoderma harzianum, Dactylium dendroides, Chaetomium olivaceum and one unidentified fungus) selected for activity against Armillaria mellea. The antagonists were inoculated onto (1) live spawn of the oyster mu shroom (Pleurotus ostreatus), (2) extra-moistened or sucrose-enriched mushroom composts containing living or autoclaved mycelia of P. ostreatus or Agaricus bisporus (button mushroom), (3) pasteurized compost with or without A. bisporus mycelium, wheat bran, wheat germ and (4) spent mushroom composts with living mycelia of A. bisporus, P. ostreatus or Lentinus edodes (the Shiitake mushroom). In one experiment, a representative antagonist (isolate Th2 of T. harzianum) was grown together with the A. bisporus mycelium, while in another one, the antagonist was first grown on wheat germ or wheat bran and then on mushroom compost with living mycelium of A. bisporus. Some of the carrier substrates were then added to the roots of potted strawberry plants in the glasshouse to evaluate their effectiveness against the disease. The antagonists failed to grow on the spawn of P. ostreatus even after reinoculations and prolonged incubation. Providing extra moisture or sucrose enrichment also did not improve the growth of Th2 on mushroom composts in the presence of living mycelia of A. bisporus or P. ostreatus. The antagonist, however, grew rapidly and extensively on mushroom compost with autoclaved mycelia, and also on wheat germ and wheat bran. Colonization of the substrates by the antagonist was positively correlated with its effectiveness in the glasshouse studies. Whereas only 33.3% of the inoculated control plants survived in one experiment monitored for 560 days, 100% survival was achieved when Th2 was applied on wheat germ or wheat bran. Growth of the antagonist alone on pasteurized or sterilized compost (without A. bisporus mycelia) and simultaneous growth of the antagonist and mushroom on pasteurized compost did not improve survival over the inoculated controls, but growth over mushroom compost with the living mycelium resulted in 50% survival rate. C. olivaceum isolate Co was the most effective, resulting in overall survival rate of 83.3% compared with only 8.3% for the inoculated and 100% for the uninoculated (healthy) controls. This antagonist gave the highest survival rate of 100% on spent mushroom compost with L. edodes. T harzianum isolate Th23, with 75% survival rate, was the most effective on spent mushroom compost with P. ostreatus, while D. dendroides isolate SP resulted in equal survival rates of 50% on all the three mushroom composts.
Resumo:
Three copper(II) complexes, [CuL1], [CuL2] and [CuL3] where L-1, L-2 and L-3 are the tetradentate di-Schiff-base ligands prepared by the condensation of acetylacetone and appropriate diamines (e.g. 1,2-diaminoethane, 1,2-diaminopropane and 1,3-diaminopropane, respectively) in 2:1 ratios, have been prepared. These complexes act as host molecules and include a guest sodium ion by coordinating through the oxygen atoms to result in corresponding new trinuclear complexes, [(CuL1)(2)Na(ClO4)(H2O)][CuL1], [(CuL2)(2)Na(ClO4)(H2O)] (2) and [(CuL3)(2)Na(ClO4)(H2O)] (3) when crystallized from methanol solution containing sodium perchlorate. All three complexes have been characterized by single crystal X-ray crystallography. In all the complexes, the sodium cation has a six-coordinate distorted octahedral environment being bonded to four oxygen atoms from two Schiff-base complexes of Cu(II) in addition to a perchlorate anion and a water molecule. The copper atoms are four coordinate in a square planar environment being bonded to two oxygen atoms and two nitrogen atoms of the Schiff-base ligand. The variable temperature susceptibilities for complexes 1-3 were measured over the range 2-300 K. The isotropic Hamiltonian, H = g(1)beta HS1 + g(2)beta HS2 + J(12)S(1)S(2) + g(3)beta HS3 for complex 1 and H = g(1)beta HS1 + g2 beta HS2 +J(12)S(1)S(2) for complexes 2 and 3 has been used to interpret the magnetic data. The best fit parameters obtained are: g(1) = g(2) = 2.07(0), J = - 1.09(1) cm(-1) for complex 1, g(1) = g(2) = 2.06(0), J = -0.55(1) cm(-1) for complex 2 and g1 = g2 = 2.07(0).J = -0.80(1) cm(-1) for 3. Electrochemical studies displayed an irreversible Cu(II)/Cu(I) one-electron reduction process. (C) 2008 Elsevier Ltd. All rights reserved.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
Two Schiff bases, HL1 and HL2 have been prepared by the condensation of N-methyl-1,3-propanediamine (mpn) with salicylaldehyde and 1-benzoylacetone (Hbn) respectively. HL1 on reaction with Cu(ClO4)(2)center dot 6H(2)O in methanol produced a trinuclear Cu-II complex, [(CuL1)(3)(mu(3)-OH)](ClO4)(2)center dot H2O center dot 0.5CH(2)Cl(2) (1) but HL2 underwent hydrolysis under similar reaction conditions to result in a ternary Cu-II complex, [Cu(bn)(mpn)ClO4]. Both complexes have been characterised by single-crystal X-ray analyses, IR and UV-Vis spectroscopy and electrochemical studies. The partial cubane core [Cu3O4] of 1 consists of a central mu(3)-OH and three peripheral phenoxo bridges from the Schiff base. All three copper atoms of the trinuclear unit are five-coordinate with a distorted square-pyramidal geometry. The ternary complex 2 is mononuclear with the square-pyramidal Cu-II coordinated by a chelating bidentate diamine (mpn) and a benzoylacetonate (bn) moiety in the equatorial plane and one of the oxygen atoms of perchlorate in an axial position. The results show that the Schiff base (HL2) derived from 1-benzoylacetone is more prone to hydrolysis than that from salicylaldehyde (HL1). Magnetic measurements of 1 have been performed in the 1.8-300 K temperature range. The experimental data clearly indicate antiferromagnetism in the complex. The best-fit parameters for complex 1 are g = 2.18(1) and J = -15.4(2) cm(-1).
Resumo:
A square-planar compound [Cu(pyrimol)Cl] (pyrimol = 4-methyl-2-N-(2-pyridylmethylene)aminophenolate) abbreviated as CuL–Cl) is described as a biomimetic model of the enzyme galactose oxidase (GOase). This copper(II) compound is capable of stoichiometric aerobic oxidation of activated primary alcohols in acetonitrile/water to the corresponding aldehydes. It can be obtained either from Hpyrimol (HL) or its reduced/hydrogenated form Hpyramol (4-methyl-2-N-(2-pyridylmethyl)aminophenol; H2L) readily converting to pyrimol (L-) on coordination to the copper(II) ion. Crystalline CuL–Cl and its bromide derivative exhibit a perfect square-planar geometry with Cu–O(phenolate) bond lengths of 1.944(2) and 1.938(2) Å. The cyclic voltammogram of CuL–Cl exhibits an irreversible anodic wave at +0.50 and +0.57 V versus ferrocene/ferrocenium (Fc/Fc+) in dry dichloromethane and acetonitrile, respectively, corresponding to oxidation of the phenolate ligand to the corresponding phenoxyl radical. In the strongly donating acetonitrile the oxidation path involves reversible solvent coordination at the Cu(II) centre. The presence of the dominant CuII–L. chromophore in the electrochemically and chemically oxidised species is evident from a new fairly intense electronic absorption at 400–480 nm ascribed to a several electronic transitions having a mixed pi-pi(L.) intraligand and Cu–Cl -> L. charge transfer character. The EPR signal of CuL–Cl disappears on oxidation due to strong intramolecular antiferromagnetic exchange coupling between the phenoxyl radical ligand (L.) and the copper(II) centre, giving rise to a singlet ground state (S = 0). The key step in the mechanism of the primary alcohol oxidation by CuL–Cl is probably the alpha-hydrogen abstraction from the equatorially bound alcoholate by the phenoxyl moiety in the oxidised pyrimol ligand, Cu–L., through a five-membered cyclic transition state.
Resumo:
Purpose of review Evidence suggests that short-chain fatty acids (SCFAs) derived from microbial metabolism in the gut play a central role in host homeostasis. The present review describes the current understanding and physiological implications of SCFAs derived from microbial metabolism of nondigestible carbohydrates. Recent findings Recent studies indicate a role for SCFAs, in particular propionate and butyrate, in the metabolic and inflammatory disorders such as obesity, diabetes and inflammatory bowel diseases, through the activation of specific G-protein-coupled receptors and modification of transcription factors. Established prebiotics, such as fructooligosaccharides and galactooligosaccharides, which support the growth of Bifidobacteria, mainly mediate acetate production. Thus, recent identification of prebiotics which are able to stimulate the production of propionate and butyrate by benign saccharolytic populations in the colon is of interest. Summary Manipulation of saccharolytic fermentation by prebiotic substrates is beginning to provide information on structure–function relationships relating to the production of SCFAs, which have multiple roles in host homeostasis.
Resumo:
We have investigated the adsorption and thermal decomposition of copper hexafluoroacetylacetonate (Cu-11(hfaC)(2)) on single crystal rutile TiO2(110). Low energy electron diffraction shows that room temperature saturation coverage of the Cu-II(hfac)(2) adsorbate forms an ordered (2 x 1) over-layer. X-ray and ultra-violet photoemission spectroscopy of the saturated surface were recorded as the sample was annealed in a sequential manner to reveal decomposition pathways. The results show that the molecule dissociatively adsorbs by detachment of one of the two ligands to form hfac and Cu-1(hfac) which chemisorb to the substrate at 298 K. These ligands only begin to decompose once the surface temperature exceeds 473 K where Cu core level shifts indicate metallisation. This reduction from Cu(I) to Cu(0) takes place in the absence of an external reducing agent and without disproportionation and is accompanied by the onset of decomposition of the hfac ligands. Finally, C K-edge near edge X-ray absorption fine structure experiments indicate that both the ligands adsorb aligned in the < 001 > direction and we propose a model in which the hfac ligands adsorb on the 5-fold coordinated Ti atoms and the Cu-1(hfac) moiety attaches to the bridging O atoms in a square planar geometry. The calculated tilt angle for these combined geometries is approximately 10 degrees to the surface normal.
Resumo:
Insects migrating over two sites in southern UK (Malvern in Worcestershire, and Harpenden in Hertfordshire) have been monitored continuously with nutating vertical-looking radars (VLRs) equipped with powerful control and analysis software. These observations make possible, for the first time, a systematic investigation of the vertical distribution of insect aerial density in the atmosphere, over temporal scales ranging from the short (instantaneous vertical profiles updated every 15 min) to the very long (profiles aggregated over whole seasons or even years). In the present paper, an outline is given of some general features of insect stratification as revealed by the radars, followed by a description of occasions during warm nights in the summer months when intense insect layers developed. Some of these nocturnal layers were due to the insects flying preferentially at the top of strong surface temperature inversions, and in other cases, layering was associated with higher-altitude temperature maxima, such as those due to subsidence inversions. The layers were formed from insects of a great variety of sizes, but peaks in the mass distributions pointed to a preponderance of medium-sized noctuid moths on certain occasions.
Resumo:
The OECD 14 d earthworm acute toxicity test was used to determine the toxicity of copper added as copper nitrate (Cu(NO3)(2)), copper sulphate (CuSO4) and malachite (Cu-2(OH)(2)(CO3)) to Eisenia fetida Savigny. Cu(NO3)(2), and CuSO4 were applied in both an aqueous (aq) and solid (s) form, Cu-2(OH)(2)(CO3) was added as a solid. Soil solution was extracted by centrifugation, and analysed for copper. Two extractants [0.01 M CaCl2 and 0.005 M diethylenetriminpentaacetic acid (DTPA)] were used as a proxy of the bioavailable copper fraction in the soil. For bulk soil copper content the calculated copper toxicity decreased in the order nitrate > sulphide > carbonate, the same order as decreasing solubility of the metal compounds. For Cu(NO3)(2) and CuSO4, the LC50s obtained were not significantly different when the compound was added in solution or solid form. There was a significant correlation between the soil solution copper concentration and the percentage earthworm mortality for all 3 copper compounds (P less than or equal to 0.05) indicating that the soil pore water copper concentration is important for determining copper availability and toxicity to E. fetida. In soil avoidance tests the earthworms avoided the soils treated with Cu(NO3)(2) (aq and s) and CuSO4 (aq and s), at all concentrations used (110-8750 mug Cu g(-1), and 600-8750 mug Cu g(-1) respectively). In soils treated with Cu-2(OH2)CO3, avoidance behaviour was exhibited at all concentrations greater than or equal to3500 mug Cu g(-1). There was no significant correlation between the copper extracted by either CaCl2 or DTPA and percentage mortality. These two extractants are therefore not useful indicators of copper availability and toxicity to E. fetida.
Resumo:
The complexation of Cu by sewage sludge-derived dissolved organic matter (SSDOM) is a process by which the environmental significance of the element may become enhanced due to reduced soil sorption and, hence, increased mobility. The work described in this paper used an ion selective electrode procedure to show that SSDOM complexation of Cu was greatest at intermediate pH values because competition between hydrogen ions and Cu for SSDOM binding sites, and between hydroxyl ions and SSDOM as Cu ligands, was lowest at such values. Batch sorption experiments further showed that the process of Cu complexation by SSDOM provided an explanation for enhanced desorption of Cu from the solid phase of a contaminated, organic matter-rich, clay loam soil, and reduced adsorption of Cu onto the solid phase of a sandy loam soil. Complexation of Cu by SSDOM did not affect uptake of Cu by spring barley plants, when compared to free ionic Cu, in a sand-culture pot experiment. However, it did appear to lead to greater biomass yields of the plant; perhaps indicating that the Cu-SSDOM complex had a lower toxicity towards the plant than the free Cu ion.