Cyclins, cyclin-dependent kinases, and cyclin-dependent kinase inhibitors: detection methods and activity measurements

The cyclin/cyclin-dependent kinase (Cdk) complexes and the Cdk inhibitors (CDKI) are crucial regulators of cell cycle progression in all eukaryotic cells. Using rat cardiac myocytes as a model system, this chapter provides a detailed account of methods that can be employed to measure both cyclin/Cdk activity in cells and the extent of CDKI inhibitory activity present in a particular cell type.

State-space model identification of a wireless THz network

We model the large scale fading of wireless THz communications links deployed in a metropolitan area taking into account reception through direct line of sight, ground or wall reflection and diffraction. The movement of the receiver in the three dimensions is modelled by an autonomous dynamic linear system in state-space whereas the geometric relations involved in the attenuation and multi-path propagation of the electric field are described by a static non-linear mapping. A subspace algorithm in conjunction with polynomial regression is used to identify a Wiener model from time-domain measurements of the field intensity.

Wiener-System subspace identification for mobile wireless mm-wave networks

We discuss the feasibility of wireless terahertz communications links deployed in a metropolitan area and model the large-scale fading of such channels. The model takes into account reception through direct line of sight, ground and wall reflection, as well as diffraction around a corner. The movement of the receiver is modeled by an autonomous dynamic linear system in state space, whereas the geometric relations involved in the attenuation and multipath propagation of the electric field are described by a static nonlinear mapping. A subspace algorithm in conjunction with polynomial regression is used to identify a single-output Wiener model from time-domain measurements of the field intensity when the receiver motion is simulated using a constant angular speed and an exponentially decaying radius. The identification procedure is validated by using the model to perform q-step ahead predictions. The sensitivity of the algorithm to small-scale fading, detector noise, and atmospheric changes are discussed. The performance of the algorithm is tested in the diffraction zone assuming a range of emitter frequencies (2, 38, 60, 100, 140, and 400 GHz). Extensions of the simulation results to situations where a more complicated trajectory describes the motion of the receiver are also implemented, providing information on the performance of the algorithm under a worst case scenario. Finally, a sensitivity analysis to model parameters for the identified Wiener system is proposed.

Application of auto regressive models of wavelet sub-bands for classifying Terahertz pulse measurements

This paper presents an approach for automatic classification of pulsed Terahertz (THz), or T-ray, signals highlighting their potential in biomedical, pharmaceutical and security applications. T-ray classification systems supply a wealth of information about test samples and make possible the discrimination of heterogeneous layers within an object. In this paper, a novel technique involving the use of Auto Regressive (AR) and Auto Regressive Moving Average (ARMA) models on the wavelet transforms of measured T-ray pulse data is presented. Two example applications are examined - the classi. cation of normal human bone (NHB) osteoblasts against human osteosarcoma (HOS) cells and the identification of six different powder samples. A variety of model types and orders are used to generate descriptive features for subsequent classification. Wavelet-based de-noising with soft threshold shrinkage is applied to the measured T-ray signals prior to modeling. For classi. cation, a simple Mahalanobis distance classi. er is used. After feature extraction, classi. cation accuracy for cancerous and normal cell types is 93%, whereas for powders, it is 98%.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Jpowder: a Java-based program for the display and examination of powder diffraction data

The ability to display and inspect powder diffraction data quickly and efficiently is a central part of the data analysis process. Whilst many computer programs are capable of displaying powder data, their focus is typically on advanced operations such as structure solution or Rietveld refinement. This article describes a lightweight software package, Jpowder, whose focus is fast and convenient visualization and comparison of powder data sets in a variety of formats from computers with network access. Jpowder is written in Java and uses its associated Web Start technology to allow ‘single-click deployment’ from a web page, http://www.jpowder.org. Jpowder is open source, free and available for use by anyone.

Using continuous ground-based radar and lidar measurements for evaluating the representation of clouds in four operational models

The ability of four operational weather forecast models [ECMWF, Action de Recherche Petite Echelle Grande Echelle model (ARPEGE), Regional Atmospheric Climate Model (RACMO), and Met Office] to generate a cloud at the right location and time (the cloud frequency of occurrence) is assessed in the present paper using a two-year time series of observations collected by profiling ground-based active remote sensors (cloud radar and lidar) located at three different sites in western Europe (Cabauw. Netherlands; Chilbolton, United Kingdom; and Palaiseau, France). Particular attention is given to potential biases that may arise from instrumentation differences (especially sensitivity) from one site to another and intermittent sampling. In a second step the statistical properties of the cloud variables involved in most advanced cloud schemes of numerical weather forecast models (ice water content and cloud fraction) are characterized and compared with their counterparts in the models. The two years of observations are first considered as a whole in order to evaluate the accuracy of the statistical representation of the cloud variables in each model. It is shown that all models tend to produce too many high-level clouds, with too-high cloud fraction and ice water content. The midlevel and low-level cloud occurrence is also generally overestimated, with too-low cloud fraction but a correct ice water content. The dataset is then divided into seasons to evaluate the potential of the models to generate different cloud situations in response to different large-scale forcings. Strong variations in cloud occurrence are found in the observations from one season to the same season the following year as well as in the seasonal cycle. Overall, the model biases observed using the whole dataset are still found at seasonal scale, but the models generally manage to well reproduce the observed seasonal variations in cloud occurrence. Overall, models do not generate the same cloud fraction distributions and these distributions do not agree with the observations. Another general conclusion is that the use of continuous ground-based radar and lidar observations is definitely a powerful tool for evaluating model cloud schemes and for a responsive assessment of the benefit achieved by changing or tuning a model cloud

A method for estimating the turbulent kinetic energy dissipation rate from a vertically pointing Doppler lidar, and independent evaluation from balloon-borne in situ measurements

A method of estimating dissipation rates from a vertically pointing Doppler lidar with high temporal and spatial resolution has been evaluated by comparison with independent measurements derived from a balloon-borne sonic anemometer. This method utilizes the variance of the mean Doppler velocity from a number of sequential samples and requires an estimate of the horizontal wind speed. The noise contribution to the variance can be estimated from the observed signal-to-noise ratio and removed where appropriate. The relative size of the noise variance to the observed variance provides a measure of the confidence in the retrieval. Comparison with in situ dissipation rates derived from the balloon-borne sonic anemometer reveal that this particular Doppler lidar is capable of retrieving dissipation rates over a range of at least three orders of magnitude. This method is most suitable for retrieval of dissipation rates within the convective well-mixed boundary layer where the scales of motion that the Doppler lidar probes remain well within the inertial subrange. Caution must be applied when estimating dissipation rates in more quiescent conditions. For the particular Doppler lidar described here, the selection of suitably short integration times will permit this method to be applicable in such situations but at the expense of accuracy in the Doppler velocity estimates. The two case studies presented here suggest that, with profiles every 4 s, reliable estimates of ϵ can be derived to within at least an order of magnitude throughout almost all of the lowest 2 km and, in the convective boundary layer, to within 50%. Increasing the integration time for individual profiles to 30 s can improve the accuracy substantially but potentially confines retrievals to within the convective boundary layer. Therefore, optimization of certain instrument parameters may be required for specific implementations.

Investigation of liquid MALDI and optimization for instrument tuning and quantitative measurements

The success of Matrix-assisted laser desorption / ionisation (MALDI) in fields such as proteomics has partially but not exclusively been due to the development of improved data acquisition and sample preparation techniques. This has been required to overcome some of the short comings of the commonly used solid-state MALDI matrices such as - cyano-4-hydroxycinnamic acid (CHCA) and 2,5-dihydroxybenzoic acid (DHB). Solid state matrices form crystalline samples with highly inhomogeneous topography and morphology which results in large fluctuations in analyte signal intensity from spot to spot and positions within the spot. This means that efficient tuning of the mass spectrometer can be impeded and the use of MALDI MS for quantitative measurements is severely impeded. Recently new MALDI liquid matrices have been introduced which promise to be an effective alternative to crystalline matrices. Generally the liquid matrices comprise either ionic liquid matrices (ILMs) or a usually viscous liquid matrix which is doped with a UV lightabsorbing chromophore [1-3]. The advantages are that the droplet surface is smooth and relatively uniform with the analyte homogeneously distributed within. They have the ability to replenish a sampling position between shots negating the need to search for sample hot-spots. Also the liquid nature of the matrix allows for the use of additional additives to change the environment to which the analyte is added.

Principles and calibration of solid phase microextraction fibre (passive sampler) for measurements of airflow and air infiltration in dwellings

Tracer gas techniques have been the most appropriate experimental method of determining airflows and ventilation rates in houses. However, current trends to reduce greenhouse gas effects have prompted the need for alternative techniques, such as passive sampling. In this research passive sampling techniques have been used to demonstrate the potential to fulfil these requirements by using solutions of volatile organic compounds (VOCs) and solid phase microextraction (SPME) fibres. These passive sampling techniques have been calibrated against tracer gas decay techniques and measurements from a standard orifice plate. Two constant sources of volatile organic compounds were diffused into two sections of a humidity chamber and sampled using SPME fibres. From a total of four SPME fibres (two in each section), reproducible results were obtained. Emission rates and air movement from one section to the other were predicted using developed algorithms. Comparison of the SPME fibre technique with that of the tracer gas technique and measurements from an orifice plate showed similar results with good precision and accuracy. With these fibres, infiltration rates can be measured over grab samples in a time weighted averaged period lasting from 10 minutes up to several days. Key words: passive samplers, solid phase microextraction fibre, tracer gas techniques, airflow, air infiltration, houses.

Variability in surface atmospheric electric field measurements

An electrical current of the order one picoamp per metre squared flows vertically in the Earth's atmosphere, between the ionosphere at approximately 50km altitude and the surface. This current is generated by global thunderstorm activity and is modulated by galactic cosmic rays and atmospheric aerosol. In fair weather conditions, this current cause a vertical atmospheric electric field, commonly measured as a potential gradient. For circumstances other than fair weather conditions, the potential gradient varies, from small steady enhancements in fog to large fluctuations in thunderstorms. The atmospheric potential gradient is continuously monitored at the Reading University Atmospheric Observatory. An account of the variability of the potential gradient on a variety of time scales will be presented.

Structure of single-wall peptide nanotubes: in situ flow aligning X-ray diffraction

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Energy-dependent cancellation of diffraction spots due to surface roughening

The low-energy electron diffraction (LEED) pattern of the step-kinked Pt{531} surface at 200 K shows energy-dependent cancellation of diffraction spots over unusually large energy ranges, up to 100 eV. This cannot be reproduced theoretically when a flat surface geometry is assumed. A relatively simple model of roughening, however, involving 0.25 ML of vacancies and adatoms leads to very good agreement with the experiment. The cancellation of intensities within a very narrow range of adatom or vacancy coverages is caused by the interference of electrons emerging from different heights but similar local environments. This is a rare example where the energy dependence of integrated LEED spot intensities is dramatically affected by the long-range arrangement of atoms.

Molecular t-matrices for low-energy electron diffraction (TMOL v1.1)*1

We describe a FORTRAN-90 program that computes scattering t-matrices for a molecule. These can be used in a Low-Energy Electron Diffraction program to solve the molecular structural problem very efficiently. The intramolecular multiple scattering is computed within a Dyson-like approach, using free space Green propagators in a basis of spherical waves. The advantage of this approach is related to exploiting the chemical identity of the molecule, and to the simplicity to translate and rotate these t-matrices without performing a new multiple-scattering calculation for each configuration. FORTRAN-90 routines for rotating the resulting t-matrices using Wigner matrices are also provided.