180 resultados para Neutron scattering and diffraction


Relevância:

100.00% 100.00%

Publicador:

Resumo:

In this work, the Cloud Feedback Model Intercomparison (CFMIP) Observation Simulation Package (COSP) is expanded to include scattering and emission effects of clouds and precipitation at passive microwave frequencies. This represents an advancement over the official version of COSP (version 1.4.0) in which only clear-sky brightness temperatures are simulated. To highlight the potential utility of this new microwave simulator, COSP results generated using the climate model EC-Earth's version 3 atmosphere as input are compared with Microwave Humidity Sounder (MHS) channel (190.311 GHz) observations. Specifically, simulated seasonal brightness temperatures (TB) are contrasted with MHS observations for the period December 2005 to November 2006 to identify possible biases in EC-Earth's cloud and atmosphere fields. The EC-Earth's atmosphere closely reproduces the microwave signature of many of the major large-scale and regional scale features of the atmosphere and surface. Moreover, greater than 60 % of the simulated TB are within 3 K of the NOAA-18 observations. However, COSP is unable to simulate sufficiently low TB in areas of frequent deep convection. Within the Tropics, the model's atmosphere can yield an underestimation of TB by nearly 30 K for cloudy areas in the ITCZ. Possible reasons for this discrepancy include both incorrect amount of cloud ice water in the model simulations and incorrect ice particle scattering assumptions used in the COSP microwave forward model. These multiple sources of error highlight the non-unique nature of the simulated satellite measurements, a problem exacerbated by the fact that EC-Earth lacks detailed micro-physical parameters necessary for accurate forward model calculations. Such issues limit the robustness of our evaluation and suggest a general note of caution when making COSP-satellite observation evaluations.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

A model for the structure of amorphous molybdenum trisulfide, a-MoS3, has been created using reverse Monte Carlo methods. This model, which consists of chains Of MoS6 units sharing three sulfurs with each of its two neighbors and forming alternate long, nonbonded, and short, bonded, Mo-Mo separations, is a good fit to the neutron diffraction data and is chemically and physically realistic. The paper identifies the limitations of previous models based on Mo-3 triangular clusters in accounting for the available experimental data.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Relevância:

50.00% 50.00%

Publicador:

Resumo:

By combining the results of both x-ray diffraction and neutron total-scattering experiments, we show that Ni(CN)(2) exhibits long-range structural order only in two dimensions, with no true periodicity perpendicular to its gridlike layers. Reverse Monte Carlo analysis gives an experimental distinction between M-C and M-N bond lengths in a homometallic cyanide framework and identifies the vibrational modes responsible for anomalous positive and negative thermal expansion in the title compound.

Relevância:

50.00% 50.00%

Publicador:

Resumo:

The structure of gold cyanide, AuCN, has been determined at 10 and 300 K using total neutron diffraction. The structure consists of infinite -Au-(CN)-Au-(CN)-Au-(CN)- linear chains, hexagonally packed, with the gold atoms in sheets. The Au-C and Au-N bond lengths are found to be identical, with d(Au-C/N) = 1.9703(5) Angstrom at 300 K. This work supersedes a previous study, by others, which used Rietveld analysis of neutron Bragg diffraction in isolation, and found these bonds to have significantly different lengths (Deltad = 0.24 Angstrom) at 300 K. The total correlation function, T(r), at 10 and 300 K, has been modeled using information derived from total diffraction. The broadening of inter- and intrachain correlations differs markedly due to random displacements of the chains in the direction of the chain axes. This is a consequence of the relatively weak bonding between the chains. An explanation for the negative thermal expansion in the c-direction, which occurs between 10 and 300 K, is presented.

Relevância:

50.00% 50.00%

Publicador:

Resumo:

We consider a two-dimensional problem of scattering of a time-harmonic electromagnetic plane wave by an infinite inhomogeneous conducting or dielectric layer at the interface between semi-infinite homogeneous dielectric half-spaces. The magnetic permeability is assumed to be a fixed positive constant. The material properties of the media are characterized completely by an index of refraction, which is a bounded measurable function in the layer and takes positive constant values above and below the layer, corresponding to the homogeneous dielectric media. In this paper, we examine only the transverse magnetic (TM) polarization case. A radiation condition appropriate for scattering by infinite rough surfaces is introduced, a generalization of the Rayleigh expansion condition for diffraction gratings. With the help of the radiation condition the problem is reformulated as an equivalent mixed system of boundary and domain integral equations, consisting of second-kind integral equations over the layer and interfaces within the layer. Assumptions on the variation of the index of refraction in the layer are then imposed which prove to be sufficient, together with the radiation condition, to prove uniqueness of solution and nonexistence of guided wave modes. Recent, general results on the solvability of systems of second kind integral equations on unbounded domains establish existence of solution and continuous dependence in a weighted norm of the solution on the given data. The results obtained apply to the case of scattering by a rough interface between two dielectric media and to many other practical configurations.

Relevância:

50.00% 50.00%

Publicador:

Resumo:

Variable-temperature powder neutron diffraction data reveal that Co3Sn2S2 crystallizes in the shandite structure (space group R (3) over barm, a = 5.36855(3)angstrom, c = 13.1903(1) angstrom at 300 K). The structural relationship between Co3Sn2S2 and the intermetallic compound CoSn, both of which contain Kagome nets of cobalt atoms, is discussed. Resistivity and Seebeck coefficient measurements for Co3Sn2S2 are consistent with metallic behaviour. Magnetic susceptibility measurements indicate that Co3Sn2S2 orders ferromagnetically at 180(10) K, with a saturation moment of 0.29 mu(B) per cobalt atom at 5 K. The onset of magnetic ordering is accompanied by marked anomalies in the electrical transport properties. (c) 2008 Elsevier Masson SAS. All rights reserve