Optimal 3D surface reconstruction from a small number of conventional 2D X-ray images

This paper describes a method for reconstructing 3D frontier points, contour generators and surfaces of anatomical objects or smooth surfaces from a small number, e. g. 10, of conventional 2D X-ray images. The X-ray images are taken at different viewing directions with full prior knowledge of the X-ray source and sensor configurations. Unlike previous works, we empirically demonstrate that if the viewing directions are uniformly distributed around the object's viewing sphere, then the reconstructed 3D points automatically cluster closely on a highly curved part of the surface and are widely spread on smooth or flat parts. The advantage of this property is that the reconstructed points along a surface or a contour generator are not under-sampled or under-represented because surfaces or contours should be sampled or represented with more densely points where their curvatures are high. The more complex the contour's shape, the greater is the number of points required, but the greater the number of points is automatically generated by the proposed method. Given that the number of viewing directions is fixed and the viewing directions are uniformly distributed, the number and distribution of the reconstructed points depend on the shape or the curvature of the surface regardless of the size of the surface or the size of the object. The technique may be used not only in medicine but also in industrial applications.

Solving surface structures from normal incidence X-ray standing wave data

A program is provided to determine structural parameters of atoms in or adsorbed on surfaces by refinement of atomistic models towards experimentally determined data generated by the normal incidence X-ray standing wave (NIXSW) technique. The method employs a combination of Differential Evolution Genetic Algorithms and Steepest Descent Line Minimisations to provide a fast, reliable and user friendly tool for experimentalists to interpret complex multidimensional NIXSW data sets.

Modelling small angle neutron scattering data from electrospun fibres

Electrospinning is a technique employed to produce nanoscale to microscale sized fibres by the application of a high voltage to a spinneret containing a polymer solution. Here we examine how small angle neutron scattering data can be modelled to analyse the polymer chain conformation. We prepared 1:1 blends of deuterated and hydrogenated atactic-polystyrene fibres from solutions in N, N-Dimethylformamide and Methyl Ethyl Ketone. The fibres themselves often contain pores or voiding within the internal structure on the length scales that can interfere with scattering experiments. A model to fit the scattering data in order to obtain values for the radius of gyration of the polymer molecules within the fibres has been developed, that includes in the scattering from the voids. Using this model we find that the radius of gyration is 20% larger than in the bulk state and the chains are slightly extended parallel to the fibre axis.

Eliminating the small-angle component of the scattering calculated for models

A straightforward procedure (assuming spherical symmetry) is described, which enables the unwanted small-angle component of the scattering for a finite model to be calculated. The method may be applied to models of any shape or size. It is illustrated by means of a single polymer chain.

SANS/WANS time-resolving neutron scattering studies of polymer phase transitions using NIMROD

We use new neutron scattering instrumentation to follow in a single quantitative time-resolving experiment, the three key scales of structural development which accompany the crystallisation of synthetic polymers. These length scales span 3 orders of magnitude of the scattering vector. The study of polymer crystallisation dates back to the pioneering experiments of Keller and others who discovered the chain-folded nature of the thin lamellae crystals which are normally found in synthetic polymers. The inherent connectivity of polymers makes their crystallisation a multiscale transformation. Much understanding has developed over the intervening fifty years but the process has remained something of a mystery. There are three key length scales. The chain folded lamellar thickness is ~ 10nm, the crystal unit cell is ~ 1nm and the detail of the chain conformation is ~ 0.1nm. In previous work these length scales have been addressed using different instrumention or were coupled using compromised geometries. More recently researchers have attempted to exploit coupled time-resolved small-angle and wide-angle x-ray experiments. These turned out to be challenging experiments much related to the challenge of placing the scattering intensity on an absolute scale. However, they did stimulate the possibility of new phenomena in the very early stages of crystallisation. Although there is now considerable doubt on such experiments, they drew attention to the basic question as to the process of crystallisation in long chain molecules. We have used NIMROD on the second target station at ISIS to follow all three length scales in a time-resolving manner for poly(e-caprolactone). The technique can provide a single set of data from 0.01 to 100Å-1 on the same vertical scale. We present the results using a multiple scale model of the crystallisation process in polymers to analyse the results.

Low-molecular-weight gelators: Elucidating the principles of gelation based on gelator solubility and a cooperative self-assembly model

This paper highlights the key role played by solubility in influencing gelation and demonstrates that many facets of the gelation process depend on this vital parameter. In particular, we relate thermal stability (T-gel) and minimum gelation concentration (MGC) values of small-molecule gelation in terms of the solubility and cooperative self-assembly of gelator building blocks. By employing a van't Hoff analysis of solubility data, determined from simple NMR measurements, we are able to generate T-calc values that reflect the calculated temperature for complete solubilization of the networked gelator. The concentration dependence of T-calc allows the previously difficult to rationalize "plateau-region" thermal stability values to be elucidated in terms of gelator molecular design. This is demonstrated for a family of four gelators with lysine units attached to each end of an aliphatic diamine, with different peripheral groups (Z or Bee) in different locations on the periphery of the molecule. By tuning the peripheral protecting groups of the gelators, the solubility of the system is modified, which in turn controls the saturation point of the system and hence controls the concentration at which network formation takes place. We report that the critical concentration (C-crit) of gelator incorporated into the solid-phase sample-spanning network within the gel is invariant of gelator structural design. However, because some systems have higher solubilities, they are less effective gelators and require the application of higher total concentrations to achieve gelation, hence shedding light on the role of the MGC parameter in gelation. Furthermore, gelator structural design also modulates the level of cooperative self-assembly through solubility effects, as determined by applying a cooperative binding model to NMR data. Finally, the effect of gelator chemical design on the spatial organization of the networked gelator was probed by small-angle neutron and X-ray scattering (SANS/SAXS) on the native gel, and a tentative self-assembly model was proposed.

X-ray crystallographic study of DNA duplex cross-linking: simultaneous binding to two d(CGTACG)(2) molecules by a bis(9-aminoacridine-4-carboxamide) derivative

Acridine-4-carboxamides form a class of known DNA mono-intercalating agents that exhibit cytotoxic activity against tumour cell lines due to their ability to inhibit topoisomerases. Previous studies of bis-acridine derivatives have yielded equivocal results regarding the minimum length of linker necessary between the two acridine chromophores to allow bis-intercalation of duplex DNA. We report here the 1.7 angstrom resolution X-ray crystal structure of a six-carbon-linked bis(acridine-4-carboxamide) ligand bound to d(CGTACG)(2) molecules by non-covalent duplex cross-linking. The asymmetric unit consists of one DNA duplex containing an intercalated acridine-4-carboxamide chromophore at each of the two CG steps. The other half of each ligand is bound to another DNA molecule in a symmetry-related manner, with the alkyl linker threading through the minor grooves. The two crystallographically independent ligand molecules adopt distinct side chain interactions, forming hydrogen bonds to either O6 or N7 on the major groove face of guanine, in contrast to the semi-disordered state of mono-intercalators bound to the same DNA molecule. The complex described here provides the first structural evidence for the non-covalent cross-linking of DNA by a small molecule ligand and suggests a possible explanation for the inconsistent behaviour of six-carbon linked bis-acridines in previous assays of DNA bis-intercalation.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Object-based three-dimensional X-ray imaging

A form of three-dimensional X-ray imaging, called Object 3-D, is introduced, where the relevant subject material is represented as discrete ‘objects’. The surface of each such object is derived accurately from the projections of its outline, and of its other discontinuities, in about ten conventional X-ray views, distributed in solid angle. This technique is suitable for many applications, and permits dramatic savings in radiation exposure and in data acquisition and manipulation. It is well matched to user-friendly interactive displays.

Synthesis and X-ray crystal structure of the triethylammonium magnesium β-octamolybdate(VI)salt[Et3NH]2[Mg(H2O)6Mo8O26]·2H2O

[Et3NH]4[Mo8O26] reacted with MgCl2 giving the triethylammonum magnesium β-octamolybdate(VI) salt [Et3NH]2[Mg(H2O)6Mo8O26]·2H2O (3) and the triethylammonium hydronium β-octaamolybdate(VI) salt [Et3NH]3[(H3O)Mo8O26·2H2O (4), respectively. A small amount of [Et3NH]2[Mo6O269] was formed as a by-product. The salts 3 and 4 were characterized by X-ray crystallography. The [Mg(H2O)6Mo8O26]2− moiety in 3 is polymeric, with each octahedral [Mg(H2O)6]2+ ion sandwiched between two β[Mo8O26]4− ions, being hydrogen bonded to three terminal MOO oxygen atoms on one face of each β[Mo8O26]4− ion. The X-ray crystal structure of 4 corresponds to the reported previously. IR and conductivity data are given for 3 and 4.

Fulvalene cyclopentadienyl titanium and zirconium(III) and -(IV) complexes. X-Ray crystal structure of [{Ti(η5-C5H5) Cl}2 (μ-O)(μ-η5-η5-C10H8)]

The reaction of the fulvalene titanium(III) hydride [{Ti(η5-C5H5)(μ-H)}2(μ-η5-η5-C10H8)] (1) with chlorine leads to [{Ti(η5-C5H5)(μ-Cl)}2(μ-η5-η5-C10H8)] (3) and [{Ti(η5-C5H5)Cl2}2(μ-η5-η5-C10H8)] (4). The reaction of 3 with azobenzene, in wet toluene, gives [{Ti(η5-C5H5)Cl}2(μ-O)(μ-η5-η5-C10H8)] (5) and 1,2-diphenyl hydrazine. The alkylation of 4 and the analogous zirconium complex [{Zr(η5-C5H55)Cl2}2(μ-η5-η5-C10H8)] (2) with LiCH2SiMe3 or LiCH3 permits isolation of the tetraalkyl derivatives [{M(η5-C5H5)(CH2SiMe3)2}2(μ-η5-η5-C10H8)] (M  Ti (6); Zr (8)) and [{Ti(η5-C5H5)(CH3)2}2(μ-η5-η5C10H8)] (7). All the new fulvalene compounds were characterized by IR, and 1H and 13C NMR spectroscope, and mass spectra and 5 by X-ray diffraction. The structure of 5 is very similar to that of the comparable TiIV compound [{Ti(η5-C5H5)2Cl}2(μ-O)] except for the smaller TiOTi angle (159.4° against 173.81°) and a significant deviation from linearity.

Coupling between mesogenic units and polymer backbone in side-chain liquid crystal polymers and elastomers

The levels of alignment of the mesogenic units and of the polymer backbone trajectory for polyacrylate based nematic side-chain liquid crystal polymers and elastomers were evaluated by using wide angle X-ray and small angle neutron scattering procedures. The X-ray scattering measurements show that substantial levels of preferred orientation of the mesogenic units may be introduced through magnetic fields for uncrosslinked polymers and through mechanical extension for liquid crystal elastomers. Small angle neutron scattering measurements show that for highly aligned samples an anisotropic polymer backbone trajectory is observed in which the envelope is slightly extended by ∼ 10% in the direction parallel to the axis of alignment of the mesogenic units. The sense of this coupling differs from that recorded for other uncrosslinked side-chain liquid crystal polymers. Possible mechanisms to account for this anisotropy and its relationship to the properties of liquid crystal elastomers are discussed. The observed deformation behaviour of the liquid crystal elastomer is non-affine and this appears to confirm the dominating influence of the liquid crystal order of the side chains on the mechanical properties of these novel networks.

A synchrotron powder X-ray diffraction study of the skutterudite-related phases AB1.5Te1.5 (A=Co, Rh, Ir; B= Ge, Sn)

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.