Expression of four beta-galactosidases from Bifidobacterium bifidum NCIMB41171 and their contribution on the hydrolysis and synthesis of galactooligosaccharides

This paper deals with two aspects tightly related to the enzymatic characteristics and expression of four beta-galactosidases (BbgI, BbgII, BbgIII and BbgIV) from Bifidobacterium bifidum NCIMB41171. The growth patterns of this strain indicated a preference towards complex (i.e. lactose, galactooligosaccharides (GOSs)) rather than simple carbohydrates (i.e. glucose and galactose) and a collaborative action and synergistic relation of more than one beta-galactosidase isoenzyme for either lactose or GOS hydrolysis and subsequent assimilation. Native polyacrylamide gel electrophoresis analysis of protein extracts from cells growing on different carbohydrates (i.e. glucose, lactose or GOS) indicated that two lactose hydrolysing enzymes (BbgI and BbgIII) and one GOS hydrolysing enzyme (BbgII) were constitutively expressed, whereas a fourth lactose hydrolysing enzyme (BbgIV) was induced in the presence of lactose or different GOS fractions. Furthermore, the beta-galactosidase expression profiles of B. bifidum cells and the transgalactosylating properties of each individual isoenzyme, with lactose as substrate, clearly indicated that mainly three isoenzymes (BbgI, BbgIII and BbgIV) are implicated in GOS synthesis when whole B. bifidum cells are utilised. Two of the isoenzymes (BbgI and BbgIV) proved to have better transgalactosylating properties giving yields ranging from 42% to 47% whereas the rest (BbgI and BbgIII) showed lower yields (15% and 29%, respectively).

Comparative analysis of four beta-galactosidases from Bifidobacterium bifidum NCIMB41171: purification and biochemical characterisation

Four different beta-galactosidases (previously named BbgI, BbgII, BbgIII and BbgIV) from Bifidobacterium bifidum NCIMB41171 were overexpressed in Escherichia coli, purified to homogeneity and their biochemical properties and substrate preferences comparatively analysed. BbgI was forming a hexameric protein complex of 875 kDa, whereas BbgII, BbgIII and BbgIV were dimers with native molecular masses of 178, 351 and 248 kDa, respectively. BbgII was the only enzyme that preferred acidic conditions for optimal activity (pH 5.4-5.8), whereas the other three exhibited optima in more neutral pH ranges (pH 6.4-6.8). Na+ and/or K+ ions were prerequisite for BbgI and BbgIV activity in Bis-Tris-buffered solutions, whereas Mg++ was strongly activating them in phosphate-buffered solutions. BbgII and BbgIII were slightly influenced from the presence or absence of cations, with Mg++, Mn++ and Ca++ ions exerting the most positive effect. Determination of the specificity constants (k(cat)/K-m) clearly indicated that BbgI (6.11 x 10(4) s(-1) M-1), BbgIII (2.36 x 10(4) s(-1) M-1) and especially BbgIV (4.01 x 10(5) s(-1) M-1) are highly specialised in the hydrolysis of lactose, whereas BbgII is more specific for beta-D-(1 -> 6) galactobiose (5.59 x 10(4) s(-1) M-1) than lactose (1.48 x 10(3) s(-1) M-1). Activity measurements towards other substrates (e. g. beta-D-(1 -> 6) galactobiose, beta-D-(1 -> 4) galactobiose, beta-D-(1 -> 4) galactosyllactose, N-acetyllactosamine, etc.) indicated that the beta-galactosidases were complementary to each other by hydrolysing different substrates and thus contributing in a different way to the bacterial physiology.

Formation of flavour in four varieties of muskmelon (Cucumis melo L.)

The aroma volatiles of four cultivars of muskmelon were examined using solid phase microextraction, followed by gas chromatography-mass spectrometry. The melons studied were Galia, from the reticulatus group, cantaloupe, from the cantaloupensis group, and honeydew and Piel de Sapo, from the inodorus group. Quantitative and qualitative differences existed between all four cultivars. Possible pathways for the formation of volatile compounds in melons are discussed.

ExtSym: a program to aid space-group determination from powder diffraction data

Once unit-cell dimensions have been determined from a powder diffraction data set and therefore the crystal system is known (e.g. orthorhombic), the method presented by Markvardsen, David, Johnson & Shankland [Acta Cryst. (2001), A57, 47-54] can be used to generate a table ranking the extinction symbols of the given crystal system according to probability. Markvardsen et al. tested a computer program (ExtSym) implementing the method against Pawley refinement outputs generated using the TF12LS program [David, Ibberson & Matthewman (1992). Report RAL-92-032. Rutherford Appleton Laboratory, Chilton, Didcot, Oxon, UK]. Here, it is shown that ExtSym can be used successfully with many well known powder diffraction analysis packages, namely DASH [David, Shankland, van de Streek, Pidcock, Motherwell & Cole (2006). J. Appl. Cryst. 39, 910-915], FullProf [Rodriguez-Carvajal (1993). Physica B, 192, 55-69], GSAS [Larson & Von Dreele (1994). Report LAUR 86-748. Los Alamos National Laboratory, New Mexico, USA], PRODD [Wright (2004). Z. Kristallogr. 219, 1-11] and TOPAS [Coelho (2003). Bruker AXS GmbH, Karlsruhe, Germany]. In addition, a precise description of the optimal input for ExtSym is given to enable other software packages to interface with ExtSym and to allow the improvement/modification of existing interfacing scripts. ExtSym takes as input the powder data in the form of integrated intensities and error estimates for these intensities. The output returned by ExtSym is demonstrated to be strongly dependent on the accuracy of these error estimates and the reason for this is explained. ExtSym is tested against a wide range of data sets, confirming the algorithm to be very successful at ranking the published extinction symbol as the most likely. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved.

Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

A differential thermal expansion approach to crystal structure determination from powder diffraction data

Differential thermal expansion over the range 90-210 K has been applied successfully to determine the crystal structure of chlorothiazide from synchrotron powder diffraction data using direct methods. Key to the success of the approach is the use of a multi-data-set Pawley refinement to extract a set of reflection intensities that is more 'single-crystal-like' than those extracted from a single data set. The improvement in reflection intensity estimates is quantified by comparison with reference single-crystal intensities. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved

Structure determination from powder diffraction data

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

A longitudinal study of perceptual grouping by proximity, luminance and shape in infants at two, four and six months

Grouping by luminance and shape similarity has previously been demonstrated in neonates and at 4 months, respectively. By contrast, grouping by proximity has hitherto not been investigated in infancy. This is also the first study to chart the developmental emergence of perceptual grouping longitudinally. Sixty-one infants were presented with a matrix of local stimuli grouped horizontally or vertically by luminance, shape or proximity at 2, 4, and 6 months. Infants were exposed to each set of stimuli for three presentation durations. Grouping was demonstrated for luminance similarity at the earliest testing age, 2 months, by shape similarity at 4 months, but was not observed for grouping by proximity. Grouping by shape similarity showed a distinctive pattern of grouping ability across exposure durations, which reflected familiarity preferences followed by novelty preferences. This remained stable across age. No link was found between the emergence of perceptual grouping ability and the exposure duration required to elicit grouping. We conclude by stressing the importance of longitudinal studies of infant development in furthering our understanding of human cognition, rather than relying on assumptions from the adult endstate.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Jpowder: a Java-based program for the display and examination of powder diffraction data

The ability to display and inspect powder diffraction data quickly and efficiently is a central part of the data analysis process. Whilst many computer programs are capable of displaying powder data, their focus is typically on advanced operations such as structure solution or Rietveld refinement. This article describes a lightweight software package, Jpowder, whose focus is fast and convenient visualization and comparison of powder data sets in a variety of formats from computers with network access. Jpowder is written in Java and uses its associated Web Start technology to allow ‘single-click deployment’ from a web page, http://www.jpowder.org. Jpowder is open source, free and available for use by anyone.

Using continuous ground-based radar and lidar measurements for evaluating the representation of clouds in four operational models

The ability of four operational weather forecast models [ECMWF, Action de Recherche Petite Echelle Grande Echelle model (ARPEGE), Regional Atmospheric Climate Model (RACMO), and Met Office] to generate a cloud at the right location and time (the cloud frequency of occurrence) is assessed in the present paper using a two-year time series of observations collected by profiling ground-based active remote sensors (cloud radar and lidar) located at three different sites in western Europe (Cabauw. Netherlands; Chilbolton, United Kingdom; and Palaiseau, France). Particular attention is given to potential biases that may arise from instrumentation differences (especially sensitivity) from one site to another and intermittent sampling. In a second step the statistical properties of the cloud variables involved in most advanced cloud schemes of numerical weather forecast models (ice water content and cloud fraction) are characterized and compared with their counterparts in the models. The two years of observations are first considered as a whole in order to evaluate the accuracy of the statistical representation of the cloud variables in each model. It is shown that all models tend to produce too many high-level clouds, with too-high cloud fraction and ice water content. The midlevel and low-level cloud occurrence is also generally overestimated, with too-low cloud fraction but a correct ice water content. The dataset is then divided into seasons to evaluate the potential of the models to generate different cloud situations in response to different large-scale forcings. Strong variations in cloud occurrence are found in the observations from one season to the same season the following year as well as in the seasonal cycle. Overall, the model biases observed using the whole dataset are still found at seasonal scale, but the models generally manage to well reproduce the observed seasonal variations in cloud occurrence. Overall, models do not generate the same cloud fraction distributions and these distributions do not agree with the observations. Another general conclusion is that the use of continuous ground-based radar and lidar observations is definitely a powerful tool for evaluating model cloud schemes and for a responsive assessment of the benefit achieved by changing or tuning a model cloud

Structure of single-wall peptide nanotubes: in situ flow aligning X-ray diffraction

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.