125 resultados para fiducial diffraction pattern


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ability to display and inspect powder diffraction data quickly and efficiently is a central part of the data analysis process. Whilst many computer programs are capable of displaying powder data, their focus is typically on advanced operations such as structure solution or Rietveld refinement. This article describes a lightweight software package, Jpowder, whose focus is fast and convenient visualization and comparison of powder data sets in a variety of formats from computers with network access. Jpowder is written in Java and uses its associated Web Start technology to allow ‘single-click deployment’ from a web page, http://www.jpowder.org. Jpowder is open source, free and available for use by anyone.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The structure of the mixed p(3x3)-(3OH+3H(2)O) phase on Pt{111} has been investigated by low-energy electron diffraction-IV structure analysis. The OH+H2O overlayer consists of hexagonal rings of coplanar oxygen atoms interlinked by hydrogen bonds. Lateral shifts of the O atoms away from atop sites result in different O-O separations and hexagons with only large separations (2.81 and 3.02 angstrom) linked by hexagons with alternating separations of 2.49 and 2.81/3.02 A. This unusual pattern is consistent with a hydrogen-bonded network in which water is adsorbed in cyclic rings separated by OH in a p(3x3) structure. The topmost two layers of the Pt atoms relax inwards with respect to the clean surface and both show vertical buckling of up to 0.06 angstrom. In addition, significant shifts away from the lateral bulk positions have been found for the second layer of Pt atoms. (C) 2005 American Institute of Physics.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We describe a FORTRAN-90 program that computes scattering t-matrices for a molecule. These can be used in a Low-Energy Electron Diffraction program to solve the molecular structural problem very efficiently. The intramolecular multiple scattering is computed within a Dyson-like approach, using free space Green propagators in a basis of spherical waves. The advantage of this approach is related to exploiting the chemical identity of the molecule, and to the simplicity to translate and rotate these t-matrices without performing a new multiple-scattering calculation for each configuration. FORTRAN-90 routines for rotating the resulting t-matrices using Wigner matrices are also provided.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We describe a FORTRAN-90 program to compute low-energy electron diffraction I(V) curves. Plane-waves and layer doubling are used to compute the inter-layer multiple-scattering, while the intra-layer multiple-scattering is computed in the standard way expanding the wavefield on a basis of spherical waves. The program is kept as general as possible, in order to allow testing different parts of multiple-scattering calculations. In particular, it can handle non-diagonal t-matrices describing the scattering of non-spherical potentials, anisotropic vibrations, anharmonicity, etc. The program does not use old FORTRAN flavours, and has been written keeping in mind the advantage for parallelism brought forward by FORTRAN-90.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper investigates how sequential bilingual (L2) Turkish-English children comprehend English reflexives and pronouns and tests whether they pattern similarly to monolingual (L1) children, L2 adults, or children with Specific Language Impairment (SLI). Thirty nine 6- to 9-year-old L2 children with an age of onset of 30-48 months and exposure to English of 30-72 months and 33 L1 age-matched control children completed the Advanced Syntactic Test of Pronominal Reference-Revised (van der Lely, 1997). The L2 children’s performance was compared to L2 adults from Demirci (2001) and children with SLI from van der Lely & Stollwerck (1997). The L2 children’s performance in the comprehension of reflexives was almost identical to their age-matched controls, and differed from L2 adults and children with SLI. In the comprehension of pronouns, L2 children showed an asymmetry between referential and quantificational NPs, a pattern attested in younger L1 children and children with SLI. Our study provides evidence that the development of comprehension of reflexives and pronouns in these children resembles monolingual L1 acquisition and not adult L2 acquisition or acquisition of children with SLI.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pattern separation is a new technique in digital learning networks which can be used to detect state conflicts. This letter describes pattern separation in a simple single-layer network, and an application of the technique in networks with feedback.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pre-term birth is the leading cause of perinatal and neonatal mortality, 40% of which are attributed to the pre-term premature rupture of amnion. Rupture of amnion is thought to be associated with a corresponding decrease in the extracellular collagen content and/or increase in collagenase activity. However, there is very little information concerning the detailed organisation of fibrillar collagen in amnion and how this might influence rupture. Here we identify a loss of lattice like arrangement in collagen organisation from areas near to the rupture site, and present a 9% increase in fibril spacing and a 50% decrease in fibrillar organisation using quantitative measurements gained by transmission electron microscopy and the novel application of synchrotron X-ray diffraction. These data provide an accurate insight into the biomechanical process of amnion rupture and highlight X-ray diffraction as a new and powerful tool in our understanding of this process.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Gas-phase electron-diffraction (GED) data together with results from ab initio molecular orbital calculations have been used to determine the structure of propylene sulphide. Values found for the main structural parameters for the molecule are consistent with those obtained from microwave studies and are compared here with those found for similar sulphur containing rings of general formula S(CH2)n (n = 2–5). A high ring strain enthalpy was calculated for propylene sulphide which is consistent with the small C–S–C angle (48.2(6)degrees) and the relatively long C–S bond lengths (ra = 1.831(2) Å). This is thought to account for the ease of ring opening in propylene sulphide observed in MOCVD reactions and the ready polymerisation of the molecule.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The complex [(C(NH2)3)3ZrOH(CO3)3·H2O]2 (A) has been shown by means of a single crystal X-ray diffraction study to contain [C(NH2)3]+ cations and dimeric anions of formulation [(ZrOH(CO3)3)2]6−. The anion is centrosymmetric with each metal being bonded to two bridging OH groups and three chelating CO2−3 ions. The Zr atoms are thus eight coordinate with a dodecahedral environments. The ZrO distances formed by the bridgng OH groups are shorter than those formed through zirconiu carbonate interactions. The non-bonded Zr…Zr distance is 3.47(2) Å. An infrared spectroscopic investigation of A provides data which support the findings of the crystallographic study. Likewise the complex Na6(ZrOH(CO2O4)3)2·7H2O (B) contains the anion [(ZrOH(C2O4)3)2]6−. This anion is structurally related to the anion in A as each Zr atom has an eight-coordinate dodecahedral environment being bonded to two bridging OH groups and three chelating oxalate ligands, but has no imposed crysallographic symmetry. The Zr…Zr non-bonded distance is 3.50(1) Å. The OZrO bridge angles are 69.7(4)° and A and 67.4(3)° in B.