X-ray scattering study of the effect of hydration on the cross-beta structure of amyloid fibrils

We have investigated the effect of sample hydration on the wide-angle X-ray scattering patterns of amyloid fibrils from two different sources, hen egg white lysozyme (HEWL) and an 11-residue peptide taken from the sequence of transthyretin (TTR105-115). Both samples show an inter-strand reflection at 4.7 Å and an inter-sheet reflection which occurs at 8.8 and 10 Å for TTR105-115 and HEWL fibrils, respectively. The positions, widths, and relative intensities of these reflections are conserved in patterns obtained from dried stalks and hydrated samples over a range of fibril concentrations. In 2D scattering patterns obtained from flow-aligned hydrated samples, the inter-strand and inter-sheet reflections showed, respectively, axial and equatorial alignment relative to the fibril axis, characteristic of the cross-β structure. Our results show that the cross-β structure of the fibrils is not a product of the dehydrating conditions typically employed to produce aligned samples, but is conserved in individual fibrils in hydrated samples under dilute conditions comparable to those associated with other biophysical and spectroscopic techniques. This suggests a structure consisting of a stack of two or more sheets whose interfaces are inaccessible to bulk water.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Structure of single-wall peptide nanotubes: in situ flow aligning X-ray diffraction

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Small-angle x-ray scattering study of flow alignment of a thermotropic liquid crystal in the nematic and smectic phases

WThe capillary flow alignment of the thermotropic liquid crystal 4-n-octyl-4′-cyanobiphenyl in the nematic and smectic phases is investigated using time-resolved synchrotron small-angle x-ray scattering. Samples were cooled from the isotropic phase to erase prior orientation. Upon cooling through the nematic phase under Poiseuille flow in a circular capillary, a transition from the alignment of mesogens along the flow direction to the alignment of layers along the flow direction (mesogens perpendicular to flow) appears to occur continuously at the cooling rate applied. The transition is centered on a temperature at which the Leslie viscosity coefficient α3 changes sign. The configuration with layers aligned along the flow direction is also observed in the smectic phase. The transition in the nematic phase on cooling has previously been ascribed to an aligning-nonaligning or tumbling transition. At high flow rates there is evidence for tumbling around an average alignment of layers along the flow direction. At lower flow rates this orientation is more clearly defined. The layer alignment is ascribed to surface-induced ordering propagating into the bulk of the capillary, an observation supported by the parallel alignment of layers observed for a static sample at low temperatures in the nematic phase.

Synthesis, x-ray structure and anion binding properties of a cryptand-like hybrid calixpyrrole

The novel cryptand in/out-3, containing two tripyrrolemethane units briged by three 1,3- diisopropylidenbenzene arms was readily synthesized by a convergent three-step synthesis. It binds fluoride by inclusion with excellent selectivity with respect to a number of other tested anions. The structure of the free receptor and that of its fluoride complex were investigated in solution by NMR spectroscopy. The solid state X-ray structure of the free cryptand 3 was also determined.

Synthesis and crystal structure of a 3-D zinc phosphate, [C5N2H14][Zn2(PO3(OH))3], containing (4.8) net sheets

A new 3-D zinc phosphate, [C5N2H14][Zn-2(PO3(OH))(3)], has been synthesised under solvothermal conditions in the presence of 1-methylpiperazine. The structure, determined by single-crystal X-ray diffraction at 293 K (RMM = 520.9, orthorhombic, space group P2(1)2(1)2(1); a = 10.0517(2) &ANGS;, b = 10.4293(2) &ANGS; and c = 14.9050(5) &ANGS;; V = 1562.52 &ANGS;(3); Z = 4; R(F) = 2.60%, wR(F) = 2.93%), consists of vertex linked ZnO4 and PO3(OH) tetrahedra assembled into (4.8) net sheets which in turn are linked through further PO3(OH) units to generate a 3-D framework. 1-Methylpiperazinium cations reside within the 3-D channel system, held in place by a strong network of hydrogen bonds. The (4.8) net sheets occur in a number of zeolite structures e.g. ABW and GIS and related zinc phosphate phases. © 2004 Academie des sciences. Published by Elsevier SAS. All rights reserved.

Synthesis, crystal structure and magnetic properties of three unprecedented tri-nuclear and one very rare tetra-nuclear copper(II) Schiff-base complexes supported by mixed azido/phenoxo/nitrato or acetato bridges

Three novel mixed bridged trinuclear and one tetranuclear copper(II) complexes of tridentate NNO donor Schiff base ligands [Cu-3(L-1)(2)(mu(LI)-N-3)(2)(CH3OH)(2)(BF2)(2)] (1), [Cu-3(L-1)(2)(mu(LI)-NO3-I kappa O.2 kappa O')(2)] (2), [Cu-3(L-2)(2)(mu(LI)-N-3)(2)(mu-NOI-I kappa O 2 kappa O')(2)] (3) and [Cu-4(L-3)(2)(mu(LI)-N-3)(4)(mu-CH3COO-I kappa O 2 kappa O')(2)] (4) have been synthesized by reaction of the respective tridentate ligands (L-1 = 2[1-(2-dimethylamino-ethylimino)-ethyl]-phenol, L-2 = 2[1-(2-diethylamino-ethylimino)-ethyl]-phenol, L-3 = 2-[1-(2-dimethylamino-ethylimino)-methyl]-phenol) with the corresponding copper(II) salts in the presence of NaN3 The complexes are characterized by single-crystal X-ray diffraction analyses and variable-temperature magnetic measurements Complex 1 is composed of two terminal [Cu(L-1)(mu(LI)-N-3)] units connected by a central [Cu(BF4)(2)] unit through nitrogen atoms of end-on azido ligands and a phenoxo oxygen atom of the tridentate ligand The structures of 2 and 3 are very similar, the only difference is that the central unit is [Cu(NO1)(2)] and the nitrate group forms an additional mu-NO3-I kappa O 2 kappa O' bridge between the terminal and central copper atoms In complex 4, the central unit is a di-mu(L1)-N-3 bridged dicopper entity, [Cu-2(mu(L1)-N-3)(2)(CH3COO)(2)] that connects two terminal [Cu(L-3)(mu(L1)-N-3)] units through end-on azido; phenoxo oxygen and mu-CH3COO-1 kappa O center dot 2 kappa O' triple bridges to result in a tetranuclear unit Analyses of variable-temperature magnetic susceptibility data indicates that there is a global weak antiferromagnetic interaction between the copper(II) ions in complexes 1-3, with the exchange parameter J of -9 86, -11 6 and -19 98 cm(-1) for 1-3, respectively In complex 4 theoretical calculations show the presence of an antiferromagnetic coupling in the triple bridging ligands (acetato, phenoxo and azido) while the interaction through the double end-on azido bridging ligand is strongly ferromagnetic.

Coordination behavior of symmetrical hexadentate O2N2S2-donor Schiff bases toward zinc (II): synthesis, characterization, and crystal structure

Two series of zinc(II) complexes of two Schiff bases (H2L1 and H2L2) formulated as [Zn(HL1/HL2)]ClO4 (1a and 1b) and [Zn(L1/L2)] (2a and 2b), where H2L1 = 1,8-bis(salicylideneamino)-3,6-dithiaoctane and H2L2 = 1,9-bis(salicylideneamino)-3,7-dithianonane, have been prepared and isolated in pure form by changing the chemical environment. Elemental, spectral, and other physicochemical results characterize the complexes. A single crystal X-ray diffraction study confirms the structure of [Zn(HL1)]ClO4 (1a). In 1a, zinc(II) has a distorted octahedral environment with a ZnO2N2S2 chromophore.

Nickel(II) and copper(II) complexes of Schiff base ligands containing N4O2 and N4S2 donors with pyrrole terminal binding groups: synthesis, characterization, X-ray structures, DFT and electrochemical studies

A series of hexadentate ligands, H2Lm (m = 1−4), [1H-pyrrol-2-ylmethylene]{2-[2-(2-{[1H-pyrrol-2-ylmethylene]amino}phenoxy)ethoxy]phenyl}amine (H2L1), [1H-pyrrol-2-ylmethylene]{2-[4-(2-{[1H-pyrrol-2-ylmethylene]amino}phenoxy)butoxy]phenyl}amine (H2L2), [1H-pyrrol-2-ylmethylene][2-({2-[(2-{[1H-pyrrol-2-ylmethylene]amino}phenyl)thio]ethyl}thio)phenyl]amine (H2L3) and [1H-pyrrol-2-ylmethylene][2-({4-[(2-{[1H-pyrrol-2-lmethylene]amino}phenyl)thio]butyl}thio) phenyl]amine (H2L4) were prepared by condensation reaction of pyrrol-2-carboxaldehyde with {2-[2-(2-aminophenoxy)ethoxy]phenyl}amine, {2-[4-(2-aminophenoxy)butoxy]phenyl}amine, [2-({2-[(2-aminophenyl)thio]ethyl}thio)phenyl]amine and [2-({4-[(2-aminophenyl)thio]butyl}thio)phenyl]amine respectively. Reaction of these ligands with nickel(II) and copper(II) acetate gave complexes of the form MLm (m = 1−4), and the synthesized ligands and their complexes have been characterized by a variety of physico-chemical techniques. The solid and solution states investigations show that the complexes are neutral. The molecular structures of NiL3 and CuL2, which have been determined by single crystal X-ray diffraction, indicate that the NiL3 complex has a distorted octahedral coordination environment around the metal while the CuL2 complex has a seesaw coordination geometry. DFT calculations were used to analyse the electronic structure and simulation of the electronic absorption spectrum of the CuL2 complex using TDDFT gives results that are consistent with the measured spectroscopic behavior of the complex. Cyclic voltammetry indicates that all copper complexes are electrochemically inactive but the nickel complexes with softer thioethers are more easily oxidized than their oxygen analogs.

Steric stabilisation of the P_P bond in a bulky tetraorganodiphosphine: synthesis, characterisation and X-ray structure determination of tetrakis(2,4,6-triisopropylphenyl)diphosphine

We report the synthesis and characterisation of tetrakis(2,4,6-triisopropylphenyl)diphosphine. Synthesis is effected by the treatment of PCl3 with an excess of 2,4,6-triisopropylphenyllithium (or the equivalent Grignard reagent) in 70% yield. While under normal circumstances the triarylphosphine would be expected, excessive bulk prevents this, and the resulting diphosphine is, unusually, stable to PP cleavage by further organolithium moieties. The compound is stable, both thermally (m.p. 185°C) and to air and water in the solid state, although conversion to the equivalent diorganophosphinate ester is effected by boiling ethanolic solutions in air. Crystallisation from hexane/ethanol afforded pale yellow crystals of X-ray quality. The molecule is characterised by m.p., IR, NMR, elemental analysis (C, H, P) and MS. The X-ray structure shows an antiperiplanar conformation with a PP separation of 2.2461(16) Å. Comparisons are made with other diphosphines, the title compound being only the fourth simple diphosphine to be structurally characterised.

The anions [(ZrOH(CO3)3)2]6− and [(ZrOH(C2O4)3)2]6−: single crystal X-ray diffraction studies of the complexes guanidinium zirconium carbonate [(C(NH2)3)3ZrOH(CO3)3·H2O]2 and sodium zirconium oxalate Na6(ZrOH(C2O4)3)2·7H2O

The complex [(C(NH2)3)3ZrOH(CO3)3·H2O]2 (A) has been shown by means of a single crystal X-ray diffraction study to contain [C(NH2)3]+ cations and dimeric anions of formulation [(ZrOH(CO3)3)2]6−. The anion is centrosymmetric with each metal being bonded to two bridging OH groups and three chelating CO2−3 ions. The Zr atoms are thus eight coordinate with a dodecahedral environments. The ZrO distances formed by the bridgng OH groups are shorter than those formed through zirconiu carbonate interactions. The non-bonded Zr…Zr distance is 3.47(2) Å. An infrared spectroscopic investigation of A provides data which support the findings of the crystallographic study. Likewise the complex Na6(ZrOH(CO2O4)3)2·7H2O (B) contains the anion [(ZrOH(C2O4)3)2]6−. This anion is structurally related to the anion in A as each Zr atom has an eight-coordinate dodecahedral environment being bonded to two bridging OH groups and three chelating oxalate ligands, but has no imposed crysallographic symmetry. The Zr…Zr non-bonded distance is 3.50(1) Å. The OZrO bridge angles are 69.7(4)° and A and 67.4(3)° in B.

An unexpected photoadduct of N-carbomethoxymethylpyrrolidine with a chiral butenolide and benzophenone: X-ray structure and synthetic utility

The regio- and stereoselective photoinduced addition of N-carbomethoxymethylpyrrolidine to 5(S)-tert-butyldimethylsiloxymethyl-furan-2(5H)-one in the presence of benzophenone yields 3(R)-[N-(diphenylhydroxymethyl)carbo methoxymethylpyrrolidin-2′-yl]-4(S)-tert-butyldimethylsiloxymethyl)-butan-4-olides (epimeric at C-2′), and we report the X-ray structure of the major adduct together with its conversion into the 1-azabicyclo[4.3.0]-nonane ring system.