374 resultados para Patanelli, Matthew
Resumo:
A 2,500 word article on the subject of euergetism in the ancient Greek and Roman world in a major international encyclopaedia of political theory.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The collection efficiency of two widely used gunshot residue (GSR) collection techniques—carbon-coated adhesive stubs and alcohol swabs—has been compared by counting the number of characteristic GSR particles collected from the firing hand of a shooter after firing one round. Samples were analyzed with both scanning electron microscopy and energy dispersive X-rays by an experienced GSR analyst, and the number of particles on each sample containing Pb, Ba, and Sb counted. The adhesive stubs showed a greater collection efficiency as all 24 samples gave positive results for GSR particles whereas the swabs gave only positive results for half of the 24 samples. Results showed a statistically significant collection efficiency for the stub collection method and likely reasons for this are considered.
Resumo:
This article provides a brief critique of a recent article on biomineralisation and preservation. It gives a summary of the difference between biomineralisation and mineral replacement, and addresses problems with the interpretation of FT-IR data. The lack of contextual information for the samples studied is another problem which is highlighted.
Resumo:
Climate change is expected to produce reductions in water availability in England, potentially necessitating adaptive action by the water industry to maintain supplies. As part of Ofwat's fifth Periodic Review (PR09), water companies recently released their draft Water Resources Management Plans, setting out how each company intends to maintain the balance between the supply and demand for water over the next 25 years, following Environment Agency guidelines. This paper reviews these plans to determine company estimates of the impact of climate change on water supply relative to other resource pressures. The approaches adopted for incorporating the impact in the plans and the proposed management solutions are also identified. Climate change impacts for individual resource zones range from no reductions in deployable output to greater than 50% over the planning period. The estimated national aggregated loss of deployable output under a “core” climate scenario is ~520 Ml/d (3% of deployable output) by 2034/35, the equivalent of the supply of one entire water company (South West Water). Climate change is the largest single driver of change in water supplies over the planning period. Over half of the climate change impact is concentrated in southern England. In extreme cases, climate change uncertainty is of the same magnitude as the change under the core scenario (up to a loss of ~475 Ml/d). 44 of the 68 resource zones with available data are estimated to have a climate change impact. In 35 of these climate change has the greatest impact although in 10 zones sustainability reductions have a greater impact. Of the overall change in downward pressure on the supply-demand balance over the planning period, ~56% is accounted for by increased demand (620 Ml/d) and supply side climate change accounts for ~37% (407 Ml/d). Climate change impacts have a cumulative impact in concert with other changing supply side reducing components increasing the national pressure on the supply-demand balance. Whilst the magnitude of climate change appears to justify its explicit consideration, it is rare that adaptation options are planned solely in response to climate change but as a suite of options to provide a resilient supply to a range of pressures (including significant demand side pressures). Supply-side measures still tend to be considered by water companies to be more reliable than demand-side measures.
Resumo:
This paper presents preliminary results from an assessment of the barriers to adaptation to water supply shortage in a case study catchment in south east England with multiple supply companies. The investigation applies a conceptual framework, which distinguishes between generic barriers affecting the ability of supply companies to make adaptation decisions, and specific barriers to the implementation of each option. The preliminary analysis suggests that whilst there is a widespread awareness of the challenge of climate change, and a conceptual understanding of the need for adaptation, some of the generic barriers that will affect detailed evaluations and actual adaptation decisions have yet to be approached. The analysis also shows that different individual adaptation options are assessed differently by different stakeholders, and that there are differences in the barriers to adoption between supply-side and demand-side measures. First, however, the paper develops the general conceptual framework for the characterisation of the barriers to adaptation used in the study.
Resumo:
The discovery of polymers with stimuli responsive physical properties is a rapidly expanding area of research. At the forefront of the field are self-healing polymers, which, when fractured can regain the mechanical properties of the material either autonomically, or in response to a stimulus. It has long been known that it is possible to promote healing in conventional thermoplastics by heating the fracture zone above the Tg of the polymer under pressure. This process requires reptation and subsequent re-entanglement of macromolecules across the fracture void, which serves to bridge, and ‘heal’ the crack. The timescale for this mechanism is highly dependent on the molecular weight of the polymer being studied. This process is in contrast to that required to affect healing in supramolecular polymers such as the plasticised, hydrogen bonded elastomer reported by Leibler et al. The disparity in bond energies between the non-covalent and covalent bonds within supramolecular polymers results in fractures propagating through scission of the comparatively weak supramolecular interactions, rather than through breaking the stronger, covalent bonds. Thus, during the healing process the macromolecules surrounding the fracture site only need sufficient energy to re-engage their supramolecular interactions in order to regenerate the strength of the pristine material. Herein we describe the design, synthesis and optimization of a new class of supramolecular polymer blends that harness the reversible nature of pi-pi stacking and hydrogen bonding interactions to produce self-supporting films with facile healable characteristics.
Resumo:
Given the extensive use of polymers in the modern age with applications ranging from aerospace components to microcircuitry, the ability to regain the mechanical and physical characteristics of complex pristine materials after damage is an attractive proposition. This tutorial review focusses upon the key chemical concepts that have been successfully utilised in the design of healable polymeric materials.
Resumo:
The behaviour of the lattice parameters of HTCuCN (high-temperature form), AgCN and AuCN have been investigated as a function of temperature over the temperature range 90–490 K. All materials show one-dimensional negative thermal expansion (NTE) along the ––(M––CN)–– chain direction c (ac(HT-CuCN) ¼32.1 10–6 K1, ac(AgCN)¼23.910–6 K1 and ac(AuCN) ¼9.3106 K1 over the temperature range 90–490 K). The origin of this behaviour has been studied using RMC modelling of Bragg and total neutron diffraction data from AgCN and AuCN at 10 and 300 K. These analyses yield details of the local motions within the chains responsible for NTE. The low-temperature form of CuCN, LT-CuCN, has been studied using single-crystal X-ray diffraction. In this form of CuCN, wavelike distortions of the ––(Cu––CN)–– chains occur in the static structure, which are reminiscent of the motions seen in the RMC modelling of AgCN and AuCN, which are responsible for the NTE behaviour.
Resumo:
Novel macrocyclic receptors which bind electron-donor aromatic substrates via π-stacking donor- acceptor interactions are obtained by cyclo-imidization of an amine-functionalized arylether-sulfone with pyromellitic- and 1,4,5,8-naphthalene-tetracarboxylic dianhydrides. These macrocycles complex with a wide variety of π-donor substrates including tetrathiafulvalene, naphthalene, anthracene, pyrene, perylene, and functional derivatives of these polycyclic hydrocarbons. The resulting supramolecular assemblies range from simple 1:1 complexes, to [2]- and [3]-pseudorotaxanes, and even (as a result of crystallographic disorder) an apparent polyrotaxane. Direct, five-component self-assembly of a metal-centred [3]pseudorotaxane is also observed, on complexation of a macrocyclic ether-imide with 8-hydroxyquinoline in the presence of palladium(II) ions. Binding studies in solution were carried out by 1H NMR and UV-visible spectroscopy, and the stoichiometries of binding were confirmed by Job plots based on charge-transfer absorption bands. The highest association constants are found for strong π-donor guests with large surface-areas, notably perylene and 1-hydroxypyrene, for which Ka values of 1.4 x 103 and 2.3 x 103 M-1 respectively are found. Single crystal X-ray analyses of the receptors and their derived complexes reveal large, induced-fit distortions of the macrocyclic frameworks as a result of complexation. These structures provide compelling evidence for the existence of strong, attractive forces between the electronically-complementary aromatic π-systems of host and guest.
Resumo:
The thermal decomposition of the complex K-4[Ni(NO2)6]center dot H2O has been investigated over the temperature range 25-600 degrees C by a combination of infrared spectroscopy, powder X-ray diffraction, FAB-mass spectrometry and elemental analysis. The first stage of reaction is loss of water and isomerisation of one of the coordinated nitro groups to form the complex K-4 [Ni(NO2)(4) (ONO)]center dot NO2. At temperatures around 200 degrees C the remaining nitro groups within the complex isomerise to the chelating nitrite form and this process acts as a precursor to the loss of NO2 gas at temperatures above 270 degrees C. The product, which is stable up to 600 degrees C, is the complex K-4[Ni(ONO)(4)]center dot NO2, where the nickel atom is formally in the +1 oxidation state. (c) 2005 Elsevier B.V. All rights reserved.