Polymer-mediated disruption of drug crystallinity

Ibuprofen (IB), a BCS Class II compound, is a highly crystalline substance with poor solubility properties. Here we report on the disruption of this crystalline structure upon intimate contact with the polymeric carrier cross-linked polyvinylpyrrolidone (PVP-CL) facilitated by low energy simple mixing. Whilst strong molecular interactions between APIs and carriers within delivery systems would be expected on melting or through solvent depositions, this is not the case with less energetic mixing. Simple mixing of the two compounds resulted in a significant decrease in the differential scanning calorimetry (DSC) melting enthalpy for IB, indicating that approximately 30% of the crystalline content was disordered. This structural change was confirmed by broadening and intensity diminution of characteristic IB X-ray powder diffractometry (PXRD) peaks. Unexpectedly, the crystalline content of the drug continued to decrease upon storage under ambient conditions. The molecular environment of the mixture was further investigated using Fourier transform infrared (FT-IR) and Fourier transform Raman (FT-Raman) spectroscopy. These data suggest that the primary interaction between these components of the physical mix is hydrogen bonding, with a secondary mechanism involving electrostatic/hydrophobic interactions through the IB benzene ring. Such interactions and subsequent loss of crystallinity could confer a dissolution rate advantage for IB. (C) 2006 Elsevier B.V. All rights reserved.

Prefrontal social cognition network dysfunction underlying face encoding and social anxiety in fragile X syndrome

Individuals with fragile X syndrome (FXS) commonly display characteristics of social anxiety, including gaze aversion, increased time to initiate social interaction, and difficulty forming meaningful peer relationships. While neural correlates of face processing, an important component of social interaction, are altered in FXS, studies have not examined whether social anxiety in this population is related to higher cognitive processes, such as memory. This study aimed to determine whether the neural circuitry involved in face encoding was disrupted in individuals with FXS, and whether brain activity during face encoding was related to levels of social anxiety. A group of 11 individuals with FXS (5 M) and 11 age-and gender-matched control participants underwent fMRI scanning while performing a face encoding task with onlineeye-tracking. Results indicate that compared to the control group, individuals with FXS exhibited decreased activation of prefrontal regions associated with complex social cognition, including the medial and superior frontal cortex, during successful face encoding. Further, the FXS and control groups showed significantly different relationships between measures of social anxiety (including gaze-fixation) and brain activity during face encoding. These data indicate that social anxiety in FXS may be related to the inability to successfully recruit higher level social cognition regions during the initial phases of memory formation. (C) 2008 Elsevier Inc. All rights reserved.

Measurement of mother-infant interactions and the home environment in a European setting: preliminary results from a cross-cultural study

Background Infant development is adversely affected in the context of postnatal depression. This relationship may be mediated by both the nature of early mother-infant interactions and the quality of the home environment. Aim To establish the usefulness of the Global Ratings Scales of Mother-Infant Interaction and the Infant-Toddler version of the Home Observation for the Measurement of the Environment (IT-HOME), and to test expected associations of the measures with characteristics of the social context and with major or minor depression. Method Both assessments were administered postnatally in four European centres; 144 mothers were assessed with the Global Ratings Scales and 114 with the IT-HOME. Affective disorder was assessed by means of the Structured Clinical Interview for DSM-IV Disorders. Results Analyses of mother-infant interaction indicated no main effect for depression but maternal sensitivity to infant behaviour was associated with better infant communication, especially for women who were not depressed. Poor overall emotional support also reduced sensitivity scores. Poor support was also related to poorer IT-HOME scores, but there was no effect of depression. Conclusions The Global Ratings Scales were effectively applied but there was less evidence of the usefulness of the IT-HOME. Declaration of interest None.

State-of-the-art for entity-centric repository and authoring environment for multimedia

Many projects, e.g. VIKEF [13] and KIM [7], present grounded approaches for the use of entities as a means of indexing and retrieval of multimedia resources from heterogeneous sources. In this paper, we discuss the state-of-the-art of entity-centric approaches for multimedia indexing and retrieval. A summary of projects employing entity-centric repositories are portrayed. This paper also looks at the current state-of-the-art authoring environment, Macromedia Authorware, and the possibility of potential extension of this environment for entity-based multimedia authoring.

High bandwidth, large workspace haptic interaction: flying phantoms

It is well understood that for haptic interaction: free motion performance and closed-loop constrained motion performance have conflicting requirements. The difficulties for both conditions are compounded when increased workspace is required as most solutions result in a reduction of achievable impedance and bandwidth. A method of chaining devices together to increase workspace without adverse effect on performance is described and analysed. The method is then applied to a prototype, colloquially known as 'The Flying Phantom', and shown to provide high-bandwidth, low impedance interaction over the full range of horizontal movement across the front of a human user.

Impedance mismatch: some differences between the way humans and robots control interaction forces

In over forty years of research robots have made very little progress still largely confined to industrial manufacture and cute toys, yet in the same period computing has followed Moores Law where the capacity double roughly every two years. So why is there no Moores Law for robots? Two areas stand out as worthy of research to speedup progress. The first is to get a greater understanding of how human and animal brains control movement, the second to build a new generation of robots that have greater haptic sense, that is a better ability to adapt to the environment as it is encountered. A remarkable property of the cognitive-motor system in humans and animals is that it is slow. Recognising an object may take 250 mS, a reaction time of 150 mS is considered fast. Yet despite this slow system we are well designed to allow contact with the world in a variety of ways. We can anticipate an encounter, use the change of force as a means of communication and ignore sensory cues when they are not relevant. A better understanding of these process has allowed us to build haptic interfaces to mimic the interaction. Emerging from this understanding are new ways to control the contact between robots, the user and the environment. Rehabilitation robotics has all the elements in the subject to not only enable and change the lives of people with disabilities, but also to facilitate revolution change in classic robotics.

3D path planning with novel multiple 2D layered approach for complex human-robot interaction

Navigating cluttered indoor environments is a difficult problem in indoor service robotics. The Acroboter concept, a novel approach to indoor locomotion, represents unique opportunity to avoid obstacles in indoor environments by navigating the ceiling plane. This mode of locomotion requires the ability to accurately detect obstacles, and plan 3D trajectories through the environment. This paper presents the development of a resilient object tracking system, as well as a novel approach to generating 3D paths suitable for such robot configurations. Distributed human-machine interfacing allowing simulation previewing of actions is also considered in the developed system architecture.

Eye tracking and gaze based interaction within immersive virtual environments

Our eyes are input sensors which Provide our brains with streams of visual data. They have evolved to be extremely efficient, and they will constantly dart to-and-fro to rapidly build up a picture of the salient entities in a viewed scene. These actions are almost subconscious. However, they can provide telling signs of how the brain is decoding the visuals and call indicate emotional responses, prior to the viewer becoming aware of them. In this paper we discuss a method of tracking a user's eye movements, and Use these to calculate their gaze within an immersive virtual environment. We investigate how these gaze patterns can be captured and used to identify viewed virtual objects, and discuss how this can be used as a, natural method of interacting with the Virtual Environment. We describe a flexible tool that has been developed to achieve this, and detail initial validating applications that prove the concept.

Collaborative virtual environment for advanced computing

Synchronous collaborative systems allow geographically distributed participants to form a virtual work environment enabling cooperation between peers and enriching the human interaction. The technology facilitating this interaction has been studied for several years and various solutions can be found at present. In this paper, we discuss our experiences with one such widely adopted technology, namely the Access Grid. We describe our experiences with using this technology, identify key problem areas and propose our solution to tackle these issues appropriately. Moreover, we propose the integration of Access Grid with an Application Sharing tool, developed by the authors. Our approach allows these integrated tools to utilise the enhanced features provided by our underlying dynamic transport layer.

Interactions between age and apoE genotype on fasting and postprandial triglycerides levels

Objective The influences of genetic determinants on the magnitude of postprandial lipaemia are presently unclear. Here the impact of the common apolipoprotein (apo)E epsilon mutation on the postprandial triglyceride (TG) response is determined, along with an assessment of genotype penetrance according to age, body mass index and gender. Methods and results Healthy adults (n = 251) underwent a postprandial investigation, in which blood samples were taken at regular intervals after a test breakfast (0 min, 49 g fat) and lunch (330 min, 29 g fat) until 480 min after the test breakfast. There was a significant impact of apoE genotype on fasting total cholesterol (TC), (P = 0.027), LDL-cholesterol (LDL-C), (P = 0.008), and %LDL3 (P = 0.001), with higher and lower levels in the E4 and E2 carriers respectively relative to the E3/E3 genotype. Reflective of a higher fasting TG (P = 0.001), a significantly higher area under the curve for the postprandial TG response (TG AUC) was evident in the E4 carriers relative to the E3/E3 group (P = 0.038). In the group as a whole, a significant age × genotype interaction was observed for fasting TC (P = 0.021). In the participants >50 years there was a significant impact of genotype on TC (P = 0.005), LDL-C (P = 0.001) and TAG AUC (P = 0.028). Conclusions It is possible that an exaggerated postprandial lipaemia contributes to the increased coronary heart disease risk associated with carriers of the E4 allele; an effect which is more evident in older adults.

Interaction of 6,6′′-bis(5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-1,2,4-benzotriazin-3-yl)-2,2′:6′,2′′-terpyridine (CyMe4-BTTP) with some trivalent ions such as lanthanide(iii) ions and americium(iii)

The new ligand 6,6 ''-bis(5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-1,2,4-benzotriazin-3-yl)2,2':6 ',2 ''-terpyridine (CyMe4-BTTP) has been synthesized in 4 steps from 2,2':6',2 ''-terpyridine. Detailed NMR and mass spectrometry studies indicate that the ligand forms 1 : 2 complexes with lanthanide(III) perchlorates where the aliphatic rings are conformationally constrained whereas 1 : 1 complexes are formed with lanthanide(III) nitrates where the rings are conformationally mobile. An optimized structure of the 1 : 2 solution complex with Yb(III) was obtained from the relative magnitude of the induced paramagnetic shifts. X-Ray crystallographic structures of the ligand and of its 1 : 1 complex with Y(III) were also obtained. The NMR and mass spectra of [Pd(CyMe4-BTTP)](n)(2n+) are consistent with a dinuclear double helical structure (n = 2). In the absence of a phase-modifier, CyMe4-BTTP in n-octanol showed a maximum distribution coefficient of Am(III) of 0.039 (+/-20%) and a maximum separation factor of Am(III) over Eu(III) of 12.0 from nitric acid. The metal(III) cations are extracted as the 1 : 1 complex from nitric acid. The generally low distribution coefficients observed compared with the BTBPs arise because the 1 : 1 complex of CyMe4-BTTP is considerably less hydrophobic than the 1 : 2 complexes formed by the BTBPs. In M(BTTP)(3+) complexes, there is a competition between the nitrate ions and the ligand for the complexation of the metal.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

A model of intelligent building energy management for the indoor environment

People's interaction with the indoor environment plays a significant role in energy consumption in buildings. Mismatching and delaying occupants' feedback on the indoor environment to the building energy management system is the major barrier to the efficient energy management of buildings. There is an increasing trend towards the application of digital technology to support control systems in order to achieve energy efficiency in buildings. This article introduces a holistic, integrated, building energy management model called `smart sensor, optimum decision and intelligent control' (SMODIC). The model takes into account occupants' responses to the indoor environments in the control system. The model of optimal decision-making based on multiple criteria of indoor environments has been integrated into the whole system. The SMODIC model combines information technology and people centric concepts to achieve energy savings in buildings.

Physiological expression of human thermal comfort to indoor operative temperature in the non-HVAC environment

A physiological experiment was carried out in a naturally ventilated, non-HVAC indoor environment of a spacious experimental room. More than 300 healthy university students volunteered for this study. The purpose of the study was to investigate the human physiological indicators which could be used to characterise the indoor operative temperature changes in a building and their impact on human thermal comfort based on the different climatic characteristics people would experience in Chongqing, China. The study found that sensory nerve conduction velocity (SCV) could objectively provide a good indicator for assessment of the human response to changes in indoor operative temperatures in a naturally ventilated situation. The results showed that with the changes in the indoor operative temperatures, the changing trend in the nerve conduction velocity was basically the same as that of the skin temperature at the sensory nerve measuring segment (Tskin(scv)). There was good coherent consistency among the factors: indoor operative temperature, SCV and Tskin(scv) in a certain indoor operative temperature range. Through self-adaptation and self-feedback regulation, the human physiological indicators would produce certain adaptive changes to deal with the changes in indoor operative temperature. The findings of this study should provide the baseline data to inform guidelines for the development of thermal environment-related standards that could contribute to efficient use of energy in buildings in China.

Interaction of nitrogen dioxide (NO2) with a monolayer of oleic acid at the air–water interface – A simple proxy for atmospheric aerosol

The reactions between atmospheric oxidants and organic amphiphiles at the air water interface of an aerosol droplet may affect the size and critical supersaturation required for cloud droplet formation. We demonstrate that no reaction occurs between gaseous nitrogen dioxide (1000 ppm in air) and a monolayer of an insoluble amphiphile, oleic acid (cis-9-octadecenoic acid), at the air water interface which removes material from the air water interface. We present evidence that the NO2 isomerises the cis-9-octadecenoic (oleic) acid to trans-9-octadecenoic (elaidic) acid. The study presented here is important for future and previous studies of (1) the reaction between the nitrate radical, NO3, and thin organic films as NO2 is usually present in high concentrations in these experimental systems and (2) the effect of NO2 air pollution on the unsaturated fatty acids and lipids found at the air liquid surface of human lung lining fluid.