X-ray scattering study of the effect of hydration on the cross-beta structure of amyloid fibrils

We have investigated the effect of sample hydration on the wide-angle X-ray scattering patterns of amyloid fibrils from two different sources, hen egg white lysozyme (HEWL) and an 11-residue peptide taken from the sequence of transthyretin (TTR105-115). Both samples show an inter-strand reflection at 4.7 Å and an inter-sheet reflection which occurs at 8.8 and 10 Å for TTR105-115 and HEWL fibrils, respectively. The positions, widths, and relative intensities of these reflections are conserved in patterns obtained from dried stalks and hydrated samples over a range of fibril concentrations. In 2D scattering patterns obtained from flow-aligned hydrated samples, the inter-strand and inter-sheet reflections showed, respectively, axial and equatorial alignment relative to the fibril axis, characteristic of the cross-β structure. Our results show that the cross-β structure of the fibrils is not a product of the dehydrating conditions typically employed to produce aligned samples, but is conserved in individual fibrils in hydrated samples under dilute conditions comparable to those associated with other biophysical and spectroscopic techniques. This suggests a structure consisting of a stack of two or more sheets whose interfaces are inaccessible to bulk water.

Synthesis, reactivity, and X-ray crystal structure of some mixed-ligand oxovanadium(V) complexes: first report of binuclear oxovanadium(V) complexes containing 4,4 '-Bipyridine type bridge

Reaction of the tridentate ONO Schiff-base ligand 2-hydroxybenzoylhydrazone of 2-hydroxybenzoylhydrazine (H2L) with VO(acac)(2) in ethanol medium produces the oxoethoxovanadium(V) complex [VO(OEt)L] (A), which reacts with pyridine to form [VO(OEt)L center dot(py)] (1). Complex 1 is structurally characterized. It has a distorted octahedral O4N2 coordination environment around the V(V) acceptor center. Both complexes A and 1 in ethanol medium react with neutral monodentate Lewis bases 2-picoline, 3-picoline, 4-picoline, 4-amino pyridine, imidazole, and 4-methyl imidazole, all of which are stronger bases than pyridine, to produce dioxovanadium(V) complexes of general formula BH[VO2L]. Most of these dioxo complexes are structurally characterized, and the complex anion [VO2L](-) is found to possess a distorted square pyramidal structure. When a solution/suspension of a BH[VO2L] complex in an alcohol (ROH) is treated with HCl in the same alcohol, it is converted into the corresponding monooxoalkoxo complex [ O(OR)L], where R comes from the alcohol used as the reaction medium. Both complexes A and 1 produce the 4,4'-bipyridine-bridged binuclear complex [VO(OEt)L](2)(mu-4,4'-bipy) (2), which, to the best of our knowledge, represents the first report of a structurally characterized 4,4'-bipyridine-bridged oxovanadium(V) binuclear complex. Two similar binuclear oxovanadium(V) complexes 3 and 4 are also synthesized and characterized. All these binuclear complexes (2-4), on treatment with base B, produce the corresponding mononuclear dioxovanadium(V) complexes (5-10).

Mapping fibre orientation in complex-shaped biological systems with micrometre resolution by scanning X-ray microdiffraction

A fully automated procedure to extract and to image local fibre orientation in biological tissues from scanning X-ray diffraction is presented. The preferred chitin fibre orientation in the flow sensing system of crickets is determined with high spatial resolution by applying synchrotron radiation based X-ray microbeam diffraction in conjunction with advanced sample sectioning using a UV micro-laser. The data analysis is based on an automated detection of azimuthal diffraction maxima after 2D convolution filtering (smoothing) of the 2D diffraction patterns. Under the assumption of crystallographic fibre symmetry around the morphological fibre axis, the evaluation method allows mapping the three-dimensional orientation of the fibre axes in space. The resulting two-dimensional maps of the local fibre orientations - together with the complex shape of the flow sensing system - may be useful for a better understanding of the mechanical optimization of such tissues.

Optimal 3D surface reconstruction from a small number of conventional 2D X-ray images

This paper describes a method for reconstructing 3D frontier points, contour generators and surfaces of anatomical objects or smooth surfaces from a small number, e. g. 10, of conventional 2D X-ray images. The X-ray images are taken at different viewing directions with full prior knowledge of the X-ray source and sensor configurations. Unlike previous works, we empirically demonstrate that if the viewing directions are uniformly distributed around the object's viewing sphere, then the reconstructed 3D points automatically cluster closely on a highly curved part of the surface and are widely spread on smooth or flat parts. The advantage of this property is that the reconstructed points along a surface or a contour generator are not under-sampled or under-represented because surfaces or contours should be sampled or represented with more densely points where their curvatures are high. The more complex the contour's shape, the greater is the number of points required, but the greater the number of points is automatically generated by the proposed method. Given that the number of viewing directions is fixed and the viewing directions are uniformly distributed, the number and distribution of the reconstructed points depend on the shape or the curvature of the surface regardless of the size of the surface or the size of the object. The technique may be used not only in medicine but also in industrial applications.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Structure of single-wall peptide nanotubes: in situ flow aligning X-ray diffraction

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Small-angle x-ray scattering study of flow alignment of a thermotropic liquid crystal in the nematic and smectic phases

WThe capillary flow alignment of the thermotropic liquid crystal 4-n-octyl-4′-cyanobiphenyl in the nematic and smectic phases is investigated using time-resolved synchrotron small-angle x-ray scattering. Samples were cooled from the isotropic phase to erase prior orientation. Upon cooling through the nematic phase under Poiseuille flow in a circular capillary, a transition from the alignment of mesogens along the flow direction to the alignment of layers along the flow direction (mesogens perpendicular to flow) appears to occur continuously at the cooling rate applied. The transition is centered on a temperature at which the Leslie viscosity coefficient α3 changes sign. The configuration with layers aligned along the flow direction is also observed in the smectic phase. The transition in the nematic phase on cooling has previously been ascribed to an aligning-nonaligning or tumbling transition. At high flow rates there is evidence for tumbling around an average alignment of layers along the flow direction. At lower flow rates this orientation is more clearly defined. The layer alignment is ascribed to surface-induced ordering propagating into the bulk of the capillary, an observation supported by the parallel alignment of layers observed for a static sample at low temperatures in the nematic phase.

Synthesis, x-ray structure and anion binding properties of a cryptand-like hybrid calixpyrrole

The novel cryptand in/out-3, containing two tripyrrolemethane units briged by three 1,3- diisopropylidenbenzene arms was readily synthesized by a convergent three-step synthesis. It binds fluoride by inclusion with excellent selectivity with respect to a number of other tested anions. The structure of the free receptor and that of its fluoride complex were investigated in solution by NMR spectroscopy. The solid state X-ray structure of the free cryptand 3 was also determined.

Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

A potential lag between the open solar magnetic source flux and solar EUV and X-ray emissions as measured by the Earth's ionosphere during total solar eclipses

Measurements of the ionospheric E-region during total solar eclipses have been used to provide information about the evolution of the solar magnetic field and EUV and X-ray emissions from the solar corona and chromosphere. By measuring levels of ionisation during an eclipse and comparing these measurements with an estimate of the unperturbed ionisation levels (such as those made during a control day, where available) it is possible to estimate the percentage of ionising radiation being emitted by the solar corona and chromosphere. Previously unpublished data from the two eclipses presented here are particularly valuable as they provide information that supplements the data published to date. The eclipse of 23 October 1976 over Australia provides information in a data gap that would otherwise have spanned the years 1966 to 1991. The eclipse of 4 December 2002 over Southern Africa is important as it extends the published sequence of measurements. Comparing measurements from eclipses between 1932 and 2002 with the solar magnetic source flux reveals that changes in the solar EUV and X-ray flux lag the open source flux measurements by approximately 1.5 years. We suggest that this unexpected result comes about from changes to the relative size of the limb corona between eclipses, with the lag representing the time taken to populate the coronal field with plasma hot enough to emit the EUV and X-rays ionising our atmosphere.

3D scanning by multiple fan beam X-ray sources and sensors

*** Purpose – Computer tomography (CT) for 3D reconstruction entails a huge number of coplanar fan-beam projections for each of a large number of 2D slice images, and excessive radiation intensities and dosages. For some applications its rate of throughput is also inadequate. A technique for overcoming these limitations is outlined. *** Design methodology/approach – A novel method to reconstruct 3D surface models of objects is presented, using, typically, ten, 2D projective images. These images are generated by relative motion between this set of objects and a set of ten fanbeam X-ray sources and sensors, with their viewing axes suitably distributed in 2D angular space. *** Findings – The method entails a radiation dosage several orders of magnitude lower than CT, and requires far less computational power. Experimental results are given to illustrate the capability of the technique *** Practical implications – The substantially lower cost of the method and, more particularly, its dramatically lower irradiation make it relevant to many applications precluded by current techniques *** Originality/value – The method can be used in many applications such as aircraft hold-luggage screening, 3D industrial modelling and measurement, and it should also have important applications to medical diagnosis and surgery.

Object-based three-dimensional X-ray imaging

A form of three-dimensional X-ray imaging, called Object 3-D, is introduced, where the relevant subject material is represented as discrete ‘objects’. The surface of each such object is derived accurately from the projections of its outline, and of its other discontinuities, in about ten conventional X-ray views, distributed in solid angle. This technique is suitable for many applications, and permits dramatic savings in radiation exposure and in data acquisition and manipulation. It is well matched to user-friendly interactive displays.

Automatic X-ray screening of aircraft hold luggage

R. Benjamin (1995) addressed the application of the “object 3D” X ray reconstruction technique for electronically “unpacking” suspect items, when screening aircraft luggage. However, there is no satisfactory solution to the mass screening of hold luggage. Computed Tomography, CT, entails excessive radiation dosages, and its rate of throughput is quite inadequate. A novel variant of “object 3D” is therefore put forward, adapting some of the technology of existing cabin luggage screening systems-but on a substantially larger scale-which does achieve the required throughput at an acceptable radiation dosage and cost.