The impact of genome defense on mobile elements in Microbotryum

Repeat induced point mutation (RIP), a mechanism causing hypermutation of repetitive DNA sequences in fungi, has been described as a ‘genome defense’ which functions to inactivate mobile elements and inhibit their deleterious effects on genome stability. Here we address the interactions between RIP and transposable elements in the Microbotryum violaceum species complex. Ten strains of M. violaceum, most of which belong to different species of the fungus, were all found to contain intragenomic populations of copia-like retrotransposons. Intragenomic DNA sequence variation among the copia-like elements was analyzed for evidence of RIP. Among species with RIP, there was no significant correlation between the frequency of RIP-induced mutations and inferred transposition rate based on diversity. Two strains of M. violaceum, from two different plant species but belonging to the same fungal lineage, contained copia-like elements with very low diversity, as would result from a high transposition rate, and these were also unique in showing no evidence of the hypermutation patterns indicative of the RIP genome defense. In this species, evidence of RIP was also absent from a Class II helitron-like transposable element. However, unexpectedly the absolute repetitive element load was lower than in other strains.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Modelling small angle neutron scattering data from electrospun fibres

Electrospinning is a technique employed to produce nanoscale to microscale sized fibres by the application of a high voltage to a spinneret containing a polymer solution. Here we examine how small angle neutron scattering data can be modelled to analyse the polymer chain conformation. We prepared 1:1 blends of deuterated and hydrogenated atactic-polystyrene fibres from solutions in N, N-Dimethylformamide and Methyl Ethyl Ketone. The fibres themselves often contain pores or voiding within the internal structure on the length scales that can interfere with scattering experiments. A model to fit the scattering data in order to obtain values for the radius of gyration of the polymer molecules within the fibres has been developed, that includes in the scattering from the voids. Using this model we find that the radius of gyration is 20% larger than in the bulk state and the chains are slightly extended parallel to the fibre axis.

Relationship between phonons and thermal expansion in Zn(CN)2 and Ni(CN)2 from inelastic neutron scattering and ab initio calculations

Zn(CN)2 and Ni(CN)2 are known for exhibiting anomalous thermal expansion over a wide temperature range. The volume thermal expansion coefficient for the cubic, three dimensionally connected material, Zn(CN)2, is negative (alpha(V) = −51  10(-6) K-1) while for Ni(CN)2, a tetragonal material, the thermal expansion coefficient is negative in the two dimensionally connected sheets (alpha(a) = −7  10(-6) K-1), but the overall thermal expansion coefficient is positive (alpha(V) = 48  10(-6) K-1). We have measured the temperature dependence of phonon spectra in these compounds and analyzed them using ab initio calculations. The spectra of the two compounds show large differences that cannot be explained by simple mass renormalization of the modes involving Zn (65.38 amu) and Ni (58.69 amu) atoms. This reflects the fact that the structure and bonding are quite different in the two compounds. The calculated pressure dependence of the phonon modes and of the thermal expansion coefficient, alpha(V), are used to understand the anomalous behavior in these compounds. Our ab initio calculations indicate that phonon modes of energy approx. 2 meV are major contributors to negative thermal expansion (NTE) in both the compounds. The low-energy modes of approx.8 and 13 meV in Zn(CN)2 also contribute significantly to the NTE in Zn(CN)2 and Ni(CN)2, respectively. The measured temperature dependence of the phonon spectra has been used to estimate the total anharmonicity of both compounds. For Zn(CN)2, the temperature-dependent measurements (total anharmonicity), along with our previously reported pressure dependence of the phonon spectra (quasiharmonic), is used to separate the explicit temperature effect at constant volume (intrinsic anharmonicity).

Effects of biochar and the earthworm Eisenia fetida on the bioavailability of polycyclic aromatic hydrocarbons and potentially toxic elements

Polycyclic aromatic hydrocarbons (PAHs) and potentially toxic elements (PTEs) were monitored over 56 days in calcareous contaminated-soil amended with either or both biochar and Eisenia fetida. Biochar reduced total (449 to 306mgkg(-1)) and bioavailable (cyclodextrin extractable) (276 to 182mgkg(-1)) PAHs, PAH concentrations in E. fetida (up to 45%) but also earthworm weight. Earthworms increased PAH bioavailability by >40%. Combined treatment results were similar to the biochar-only treatment. Earthworms increased water soluble Co (3.4 to 29.2mgkg(-1)), Cu (60.0 to 120.1mgkg(-1)) and Ni (31.7 to 83.0mgkg(-1)) but not As, Cd, Pb or Zn; biochar reduced water soluble Cu (60 to 37mgkg(-1)). Combined treatment results were similar to the biochar-only treatment but gave a greater reduction in As and Cd mobility. Biochar has contaminated land remediation potential, but its long-term impact on contaminants and soil biota needs to be assessed.

'The Elements' and Hobbesian moral thinking

It is easy to read Hobbes's moral thinking as a deviant contribution to 'modern' natural law, especially if Leviathan (1651) is read through a lens provided by De Cive (1642). But The Elements of Law (1640) encourages the view that Hobbes's argument is 'physicalist', that is, that it requires no premises beyond those required by his physics of matter in motion. The Elements included a draft De Homine and its argument is intimately connected with De Cive's; it shows how such concepts as 'reason', 'right', 'natural law' and 'obligation' can be understood in physicalist terms. But Hobbes's decision to print the latter work in isolation has led to serious misunderstandings

Replication enhancer elements within the open reading frame of tick-borne encephalitis virus and their evolution within the Flavivirus genus

We provide experimental evidence of a replication enhancer element (REE) within the capsid gene of tick-borne encephalitis virus (TBEV, genus Flavivirus). Thermodynamic and phylogenetic analyses predicted that the REE folds as a long stable stem–loop (designated SL6), conserved among all tick-borne flaviviruses (TBFV). Homologous sequences and potential base pairing were found in the corresponding regions of mosquito-borne flaviviruses, but not in more genetically distant flaviviruses. To investigate the role of SL6, nucleotide substitutions were introduced which changed a conserved hexanucleotide motif, the conformation of the terminal loop and the base-paired dsRNA stacking. Substitutions were made within a TBEV reverse genetic system and recovered mutants were compared for plaque morphology, single-step replication kinetics and cytopathic effect. The greatest phenotypic changes were observed in mutants with a destabilized stem. Point mutations in the conserved hexanucleotide motif of the terminal loop caused moderate virus attenuation. However, all mutants eventually reached the titre of wild-type virus late post-infection. Thus, although not essential for growth in tissue culture, the SL6 REE acts to up-regulate virus replication. We hypothesize that this modulatory role may be important for TBEV survival in nature, where the virus circulates by non-viraemic transmission between infected and non-infected ticks, during co-feeding on local rodents.

The roles of feature-specific task set and bottom-up salience in attentional capture: An ERP study

We investigated the roles of top-down task set and bottom-up stimulus salience for feature-specific attentional capture. Spatially nonpredictive cues preceded search arrays that included a color-defined target. For target-color singleton cues, behavioral spatial cueing effects were accompanied by cueinduced N2pc components, indicative of attentional capture. These effects were only minimally attenuated for nonsingleton target-color cues, underlining the dominance of top-down task set over salience in attentional capture. Nontarget-color singleton cues triggered no N2pc, but instead an anterior N2 component indicative of top-down inhibition. In Experiment 2, inverted behavioral cueing effects of these cues were accompanied by a delayed N2pc to targets at cued locations, suggesting that perceptually salient but task-irrelevant visual events trigger location-specific inhibition mechanisms that can delay subsequent target selection.

Identification and characterisation of five novel miniature inverted-repeat transposable elements (MITEs) in amphioxus (Branchiostoma floridae)

As the sister group to vertebrates, amphioxus is consistently used as a model of genome evolution for understanding the invertebrate/vertebrate transition. The amphioxus genome has not undergone massive duplications like those in the vertebrates or disruptive rearrangements like in the genome of Ciona, a urochordate, making it an ideal evolutionary model. Transposable elements have been linked to many genomic evolutionary changes including increased genome size, modified gene expression, massive gene rearrangements, and possibly intron evolution. Despite their importance in genome evolution, few previous examples of transposable elements have been identified in amphioxus. We report five novel Miniature Inverted-repeat Transposable Elements (MITEs) identified by an analysis of amphioxus DNA sequence, which we have named LanceleTn-1, LanceleTn-2, LanceleTn-3a, LanceleTn-3b and LanceleTn-4. Several of the LanceleTn elements were identified in the amphioxus ParaHox cluster, and we suggest these have had important implications for the evolution of this highly conserved gene cluster. The estimated high copy numbers of these elements implies that MITEs are probably the most abundant type of mobile element in amphioxus, and are thus likely to have been of fundamental importance in shaping the evolution of the amphioxus genome.

Effective elements of cognitive behaviour therapy for psychosis: results of a novel type of subgroup analysis based on principal stratification

Background. Meta-analyses show that cognitive behaviour therapy for psychosis (CBT-P) improves distressing positive symptoms. However, it is a complex intervention involving a range of techniques. No previous study has assessed the delivery of the different elements of treatment and their effect on outcome. Our aim was to assess the differential effect of type of treatment delivered on the effectiveness of CBT-P, using novel statistical methodology. Method. The Psychological Prevention of Relapse in Psychosis (PRP) trial was a multi-centre randomized controlled trial (RCT) that compared CBT-P with treatment as usual (TAU). Therapy was manualized, and detailed evaluations of therapy delivery and client engagement were made. Follow-up assessments were made at 12 and 24 months. In a planned analysis, we applied principal stratification (involving structural equation modelling with finite mixtures) to estimate intention-to-treat (ITT) effects for subgroups of participants, defined by qualitative and quantitative differences in receipt of therapy, while maintaining the constraints of randomization. Results. Consistent delivery of full therapy, including specific cognitive and behavioural techniques, was associated with clinically and statistically significant increases in months in remission, and decreases in psychotic and affective symptoms. Delivery of partial therapy involving engagement and assessment was not effective. Conclusions. Our analyses suggest that CBT-P is of significant benefit on multiple outcomes to patients able to engage in the full range of therapy procedures. The novel statistical methods illustrated in this report have general application to the evaluation of heterogeneity in the effects of treatment.

Use of the ratio plot in capture-recapture estimation

Statistical graphics are a fundamental, yet often overlooked, set of components in the repertoire of data analytic tools. Graphs are quick and efficient, yet simple instruments of preliminary exploration of a dataset to understand its structure and to provide insight into influential aspects of inference such as departures from assumptions and latent patterns. In this paper, we present and assess a graphical device for choosing a method for estimating population size in capture-recapture studies of closed populations. The basic concept is derived from a homogeneous Poisson distribution where the ratios of neighboring Poisson probabilities multiplied by the value of the larger neighbor count are constant. This property extends to the zero-truncated Poisson distribution which is of fundamental importance in capture–recapture studies. In practice however, this distributional property is often violated. The graphical device developed here, the ratio plot, can be used for assessing specific departures from a Poisson distribution. For example, simple contaminations of an otherwise homogeneous Poisson model can be easily detected and a robust estimator for the population size can be suggested. Several robust estimators are developed and a simulation study is provided to give some guidance on which should be used in practice. More systematic departures can also easily be detected using the ratio plot. In this paper, the focus is on Gamma mixtures of the Poisson distribution which leads to a linear pattern (called structured heterogeneity) in the ratio plot. More generally, the paper shows that the ratio plot is monotone for arbitrary mixtures of power series densities.

Sub-agent elements for control methods in multi-agent energy management system

Increased penetration of generation and decentralised control are considered to be feasible and effective solution for reducing cost and emissions and hence efficiency associated with power generation and distribution. Distributed generation in combination with the multi-agent technology are perfect candidates for this solution. Pro-active and autonomous nature of multi-agent systems can provide an effective platform for decentralised control whilst improving reliability and flexibility of the grid.