An analysis of arithmetic averaging in approximate Riemann solvers with an application to steady, supercritical flows

An analysis of various arithmetic averaging procedures for approximate Riemann solvers is made with a specific emphasis on efficiency and a jump capturing property. The various alternatives discussed are intended for future work, as well as the more immediate problem of steady, supercritical free-surface flows. Numerical results are shown for two test problems.

A weak formulation of Roe's approximate Riemann Solver applied to 'Barotropic' flows

A weak formulation of Roe's approximate Riemann solver is applied to the equations of ‘barotropic’ flow, including the shallow water equations, and it is shown that this leads to an approximate Riemann solver recently presented for such flows.

Similarity solutions of the shallow water equations

A one-dimensional shock (bore) reflection problem is discussed for the two-dimensional shallow water equations with cylindrical symmetry. The differential equations for a similarity solution are derived and solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Similarity solutions for multicomponent flows

A one-dimensional shock-reflection test problem in the case of slab, cylindrical or spherical symmetry is discussed for multi-component flows. The differential equations for a similarity solution are derived and then solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Numerical modelling of two-way propagation of non-linear dispersive waves

We describe and implement a fully discrete spectral method for the numerical solution of a class of non-linear, dispersive systems of Boussinesq type, modelling two-way propagation of long water waves of small amplitude in a channel. For three particular systems, we investigate properties of the numerically computed solutions; in particular we study the generation and interaction of approximate solitary waves.

Acoustic trapped modes in a three-dimensional waveguide of slowly varying cross section

In this paper we develop an asymptotic scheme to approximate the trapped mode solutions to the time harmonic wave equation in a three-dimensional waveguide with a smooth but otherwise arbitrarily shaped cross section and a single, slowly varying `bulge', symmetric in the longitudinal direction. Extending the work in Biggs (2012), we first employ a WKBJ-type ansatz to identify the possible quasi-mode solutions which propagate only in the thicker region, and hence find a finite cut-on region of oscillatory behaviour and asymptotic decay elsewhere. The WKBJ expansions are used to identify a turning point between the cut-on and cut-on regions. We note that the expansions are nonuniform in an interior layer centred on this point, and we use the method of matched asymptotic expansions to connect the cut-on and cut-on regions within this layer. The behaviour of the expansions within the interior layer then motivates the construction of a uniformly valid asymptotic expansion. Finally, we use this expansion and the symmetry of the waveguide around the longitudinal centre, x = 0, to extract trapped mode wavenumbers, which are compared with those found using a numerical scheme and seen to be extremely accurate, even to relatively large values of the small parameter.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

The implications of service-dominant logic and integrated solutions on the sales function

This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.

Molecular dynamics simulations of threadlike cetyltrimethylammonium chloride micelles: effects of sodium chloride and sodium salicylate salts

We use atomistic molecular dynamics simulations to probe the effects of added sodium chloride (NaCl) and sodium salicylate (NaSal) salts on the spherical-to-threadlike micelle shape transition in aqueous solutions of cetyltrimethylammonium chloride (CTAC) surfactants. Long threadlike micelles are found to be unstable and break into spherical micelles at low concentrations or NaCl, but remain stable for 20 ns above a threshold value of [NaCl] approximate to 3.0 M, which is about 2.5 times larger than the experimental salt concentration at which the transition between spherical and rodlike micelles occurs. The chloride counterions associate weakly oil the surface of the CTAC micelles with the degree of counterion dissociation decreasing slightly with increasing [NaCl] on spherical micelles, but dropping significantly on the threadlike micelles tit high [NaCl]. This effect indicates that the electrolyte ions drive the micellar shape transition by screening the electrostatic repulsions between the micellar headgroups, The aromatic salicylate counterions, on the other hand, penetrate inside the micelle with their hydrophilic groups staying in the surfactant headgroup region and the hydrophobic groups partially embedded into the hydrophobic core of the micelle. The strong association of the salicylate ions with the surfactant headgroups leads to dense packing of the surfactant molecules, which effectively reduces the surface area per surfactant, and increases intramicellar ordering of the surfactant headgroups, favoring the formation of long threadlike micelles. Simulation predictions of the geometric and electrostatic properties of the spherical and threadlike micelles are in good agreement with experiments.

Stability of solutions of linear difference equations with periodic coefficients

This paper represents the last technical contribution of Professor Patrick Parks before his untimely death in February 1995. The remaining authors of the paper, which was subsequently completed, wish to dedicate the article to Patrick. A frequency criterion for the stability of solutions of linear difference equations with periodic coefficients is established. The stability criterion is based on a consideration of the behaviour of a frequency hodograph with respect to the origin of coordinates in the complex plane. The formulation of this criterion does not depend on the order of the difference equation.

Resource allocation analysis of the stochastic diffusion search

The Stochastic Diffusion Search (SDS) was developed as a solution to the best-fit search problem. Thus, as a special case it is capable of solving the transform invariant pattern recognition problem. SDS is efficient and, although inherently probabilistic, produces very reliable solutions in widely ranging search conditions. However, to date a systematic formal investigation of its properties has not been carried out. This thesis addresses this problem. The thesis reports results pertaining to the global convergence of SDS as well as characterising its time complexity. However, the main emphasis of the work, reports on the resource allocation aspect of the Stochastic Diffusion Search operations. The thesis introduces a novel model of the algorithm, generalising an Ehrenfest Urn Model from statistical physics. This approach makes it possible to obtain a thorough characterisation of the response of the algorithm in terms of the parameters describing the search conditions in case of a unique best-fit pattern in the search space. This model is further generalised in order to account for different search conditions: two solutions in the search space and search for a unique solution in a noisy search space. Also an approximate solution in the case of two alternative solutions is proposed and compared with predictions of the extended Ehrenfest Urn model. The analysis performed enabled a quantitative characterisation of the Stochastic Diffusion Search in terms of exploration and exploitation of the search space. It appeared that SDS is biased towards the latter mode of operation. This novel perspective on the Stochastic Diffusion Search lead to an investigation of extensions of the standard SDS, which would strike a different balance between these two modes of search space processing. Thus, two novel algorithms were derived from the standard Stochastic Diffusion Search, ‘context-free’ and ‘context-sensitive’ SDS, and their properties were analysed with respect to resource allocation. It appeared that they shared some of the desired features of their predecessor but also possessed some properties not present in the classic SDS. The theory developed in the thesis was illustrated throughout with carefully chosen simulations of a best-fit search for a string pattern, a simple but representative domain, enabling careful control of search conditions.

Biomimetic triblock copolymer membranes: from aqueous solutions to solid supports

In the present paper, we studied the preparation of biomimetic triblock copolymer (ABA) membranes in aqueous solution and their deposition into solid supports. The self-assembly structures of the ABA in aqueous solution was investigated by using optical microscopy, dynamic light scattering, electron microscopy (EM) and SAXS. Spherical and tubular polymersomes were found at the highest concentrations investigated. The mechanism of deposition on solid supports (mica and glass) was elucidated by using atomic force microscopy (AFM). The deposition results in the formation of a uniform defect-free membrane at suitable polymer concentrations.

A simple fluid cell for the study of aqueous solutions using THz time-domain spectroscopy

We describe a fluid cell for the measurement of aqueous solutions of biomolecules adapted particularly for the requirements of THz time-domain spectroscopy. The design is simple, requires small-volume samples, avoids cross-contamination and is inexpensive.