Osmotic pressure and aggregate shape in BSA/poly (ethylene glycol)-lipid/Dextran solutions

In this work we study the colloidal osmotic pressure (COP) and aggregate shape in phosphate saline buffer solutions (PH 7.4) containing bovine serum albumin (BSA), poly(ethylene glycol) lipid (PEG(2000)-PE) and Dextran (Dx). Dx was added to the BSA/PEG(2000)-PE system in order to increase the COP of the solution to levels comparable to the COP of healthy adults, with the aim of using the solution as a blood COP regulator. Dynamic light scattering and small angle X-ray scattering results shown the formation of BSA/PEG(2000)-PE/Dx aggregates in the solution. Osmometry results shown that the addition of Dx to the BSA/PE2000-PE system could successfully increase the COP, through the formation of BSA/PEG(2000)-PE/Dx aggregates. The BSA/PEG(2000)-PE/Dx solutions attained COP= 15 mm Hg, representing 60% of COP measured for healthy adults. (c) 2008 Elsevier B.V. All rights reserved.

Structure and rheology of aqueous micellar solutions and gels formed from an associative poly(oxybutylene)-poly(oxyethylene)-poly(oxybutylene) triblock copolymer

The structure and shear flow behaviour of aqueous micellar solutions and gels formed by an amphiphilic poly(oxybutylene)-poly(oxyethylene)-poly(oxybutylene) triblock copolymer with a lengthy hydrophilic poly(oxyethylene) block has been investigated by rheology, small angle neutron scattering (SANS) and small-angle X-ray scattering (SAXS). SANS revealed that bridging of chains between micelles introduces, in the micellar solution, an attractive long-range component which can be described through a potential of interaction corresponding to sticky soft spheres. The strength of the attractive interaction increases with increasing concentration. Rheology showed that the dependence of the storage modulus with temperature can be explained as a function of the micellar bridging, micellisation and phase morphology. SAXS studies showed that the orientation adopted by the system in the get phase under shear is similar to that previously observed by us for the gel phase of a poly(oxyethylene)-poly(oxybutylene) diblock copolymer with a long poly(oxyethylene) chain, suggesting that the micellar corona/core length ratio and not the architecture of the block copolymer influences the alignment of the gel phase under shear.

Miscibility studies in poly(methyl vinyl ether)/hydroxypropylcellulose binary system in aqueous solutions and solid state

The phase separation behaviour in aqueous mixtures of poly(methyl vinyl ether) and hydroxypropylcellulose has been studied by cloud points method and viscometric measurements. The miscibility of these blends in solid state has been assessed by infrared spectroscopy; methanol vapours sorption experiments and scanning electron microscopy. The values of Gibbs energy of mixing of the polymers and their blends with methanol as well as between each other were calculated. It was found that in solid state the polymers can interact with methanol very well but the polymer-polymer interactions are unfavourable. Although in aqueous solutions the polymers exhibit some intermolecular interactions their solid blends are not completely miscible. (C) 2005 Elsevier Ltd. All rights reserved.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

The implications of service-dominant logic and integrated solutions on the sales function

This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.

Survival of Lactobacillus plantarum in model solutions and fruit juices

The aim of the work was to study the survival of Lactobacillus plantarum NCIMB 8826 in model solutions and develop a mathematical model describing its dependence on pH, citric acid and ascorbic acid. A Central Composite Design (CCD) was developed studying each of the three factors at five levels within the following ranges, i.e., pH (3.0-4.2), citric acid (6-40 g/L), and ascorbic acid (100-1000 mg/L). In total, 17 experimental runs were carried out. The initial cell concentration in the model solutions was approximately 1 × 10(8)CFU/mL; the solutions were stored at 4°C for 6 weeks. Analysis of variance (ANOVA) of the stepwise regression demonstrated that a second order polynomial model fits well the data. The results demonstrated that high pH and citric acid concentration enhanced cell survival; one the other hand, ascorbic acid did not have an effect. Cell survival during storage was also investigated in various types of juices, including orange, grapefruit, blackcurrant, pineapple, pomegranate, cranberry and lemon juice. The model predicted well the cell survival in orange, blackcurrant and pineapple, however it failed to predict cell survival in grapefruit and pomegranate, indicating the influence of additional factors, besides pH and citric acid, on cell survival. Very good cell survival (less than 0.4 log decrease) was observed after 6 weeks of storage in orange, blackcurrant and pineapple juice, all of which had a pH of about 3.8. Cell survival in cranberry and pomegranate decreased very quickly, whereas in the case of lemon juice, the cell concentration decreased approximately 1.1 logs after 6 weeks of storage, albeit the fact that lemon juice had the lowest pH (pH~2.5) among all the juices tested. Taking into account the results from the compositional analysis of the juices and the model, it was deduced that in certain juices, other compounds seemed to protect the cells during storage; these were likely to be proteins and dietary fibre In contrast, in certain juices, such as pomegranate, cell survival was much lower than expected; this could be due to the presence of antimicrobial compounds, such as phenolic compounds.

Investigation of the factors influencing the survival of Bifidobacterium longum in model acidic solutions and fruit juices

The survival of Bifidobacterium longum NCIMB 8809 was studied during refrigerated storage for 6 weeks in model solutions, based on which a mathematical model was constructed describing cell survival as a function of pH, citric acid, protein and dietary fibre. A Central Composite Design (CCD) was developed studying the influence of four factors at three levels, i.e., pH (3.2–4), citric acid (2–15 g/l), protein (0–10 g/l), and dietary fibre (0–8 g/l). In total, 31 experimental runs were carried out. Analysis of variance (ANOVA) of the regression model demonstrated that the model fitted well the data. From the regression coefficients it was deduced that all four factors had a statistically significant (P < 0.05) negative effect on the log decrease [log10N0 week−log10N6 week], with the pH and citric acid being the most influential ones. Cell survival during storage was also investigated in various types of juices, including orange, grapefruit, blackcurrant, pineapple, pomegranate and strawberry. The highest cell survival (less than 0.4 log decrease) after 6 weeks of storage was observed in orange and pineapple, both of which had a pH of about 3.8. Although the pH of grapefruit and blackcurrant was similar (pH ∼3.2), the log decrease of the former was ∼0.5 log, whereas of the latter was ∼0.7 log. One reason for this could be the fact that grapefruit contained a high amount of citric acid (15.3 g/l). The log decrease in pomegranate and strawberry juices was extremely high (∼8 logs). The mathematical model was able to predict adequately the cell survival in orange, grapefruit, blackcurrant, and pineapple juices. However, the model failed to predict the cell survival in pomegranate and strawberry, most likely due to the very high levels of phenolic compounds in these two juices.

Hydrogen-bonding-driven self-assembly of PEGylated organosilica nanoparticles with poly(acrylic acid) in aqueous solutions and in layer-by-layer deposition at solid surfaces

PEGylated organosilica nanoparticles have been synthesized through self-condensation of (3-mercaptopropyl)trimethoxysilane in dimethyl sulfoxide into thiolated nanoparticles with their subsequent reaction with methoxypoly(ethylene glycol) maleimide. The PEGylated nanoparticles showed excellent colloidal stability over a wide range of pH in contrast to the parent thiolated nanoparticles, which have a tendency to aggregate irreversibly under acidic conditions (pH < 3.0). Due to the presence of a poly(ethylene glycol)-based corona, the PEGylated nanoparticles are capable of forming hydrogen-bonded interpolymer complexes with poly(acrylic acid) in aqueous solutions under acidic conditions, resulting in larger aggregates. The use of hydrogen-bonding interactions allows more efficient attachment of the nanoparticles to surfaces. The alternating deposition of PEGylated nanoparticles and poly(acrylic acid) on silicon wafer surfaces in a layer-by-layer fashion leads to multilayered coatings. The self-assembly of PEGylated nanoparticles with poly(acrylic acid) in aqueous solutions and at solid surfaces was compared to the behavior of linear poly(ethylene glycol). The nanoparticle system creates thicker layers than the poly(ethylene glycol), and a thicker layer is obtained on a poly(acrylic acid) surface than on a silica surface, because of the effects of hydrogen bonding. Some implications of these hydrogen-bonding-driven interactions between PEGylated nanoparticles and poly(acrylic acid) for pharmaceutical formulations are discussed.