160 resultados para ray transform
Resumo:
The usefulness of motor subtypes of delirium is unclear due to inconsistency in subtyping methods and a lack of validation with objective measures of activity. The activity of 40 patients was measured over 24 h with a discrete accelerometer-based activity monitor. The continuous wavelet transform (CWT) with various mother wavelets were applied to accelerometry data from three randomly selected patients with DSM-IV delirium that were readily divided into hyperactive, hypoactive, and mixed motor subtypes. A classification tree used the periods of overall movement as measured by the discrete accelerometer-based monitor as determining factors for which to classify these delirious patients. This data used to create the classification tree were based upon the minimum, maximum, standard deviation, and number of coefficient values, generated over a range of scales by the CWT. The classification tree was subsequently used to define the remaining motoric subtypes. The use of a classification system shows how delirium subtypes can be categorized in relation to overall motoric behavior. The classification system was also implemented to successfully define other patient motoric subtypes. Motor subtypes of delirium defined by observed ward behavior differ in electronically measured activity levels.
Resumo:
This paper describes a method for reconstructing 3D frontier points, contour generators and surfaces of anatomical objects or smooth surfaces from a small number, e. g. 10, of conventional 2D X-ray images. The X-ray images are taken at different viewing directions with full prior knowledge of the X-ray source and sensor configurations. Unlike previous works, we empirically demonstrate that if the viewing directions are uniformly distributed around the object's viewing sphere, then the reconstructed 3D points automatically cluster closely on a highly curved part of the surface and are widely spread on smooth or flat parts. The advantage of this property is that the reconstructed points along a surface or a contour generator are not under-sampled or under-represented because surfaces or contours should be sampled or represented with more densely points where their curvatures are high. The more complex the contour's shape, the greater is the number of points required, but the greater the number of points is automatically generated by the proposed method. Given that the number of viewing directions is fixed and the viewing directions are uniformly distributed, the number and distribution of the reconstructed points depend on the shape or the curvature of the surface regardless of the size of the surface or the size of the object. The technique may be used not only in medicine but also in industrial applications.
Resumo:
A novel radix-3/9 algorithm for type-III generalized discrete Hartley transform (GDHT) is proposed, which applies to length-3(P) sequences. This algorithm is especially efficient in the case that multiplication is much more time-consuming than addition. A comparison analysis shows that the proposed algorithm outperforms a known algorithm when one multiplication is more time-consuming than five additions. When combined with any known radix-2 type-III GDHT algorithm, the new algorithm also applies to length-2(q)3(P) sequences.
Resumo:
We consider a quantity κ(Ω)—the distance to the origin from the null variety of the Fourier transform of the characteristic function of Ω. We conjecture, firstly, that κ(Ω) is maximised, among all convex balanced domains of a fixed volume, by a ball, and also that κ(Ω) is bounded above by the square root of the second Dirichlet eigenvalue of Ω. We prove some weaker versions of these conjectures in dimension two, as well as their validity for domains asymptotically close to a disk, and also discuss further links between κ(Ω) and the eigenvalues of the Laplacians.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The cloud-air transition zone at stratiform cloud edges is an electrically active region where droplet charging has been predicted. Cloud edge droplet charging is expected from vertical flow of cosmic ray generated atmospheric ions in the global electric circuit. Experimental confirmation of stratiform cloud edge electrification is presented here, through charge and droplet measurements made within an extensive layer of supercooled stratiform cloud, using a specially designed electrostatic sensor. Negative space charge up to 35 pC m−3 was found in a thin (<100 m) layer at the lower cloud boundary associated with the clear air-cloud conductivity gradient, agreeing closely with space charge predicted from the measured droplet concentration using ion-aerosol theory. Such charge levels carried by droplets are sufficient to influence collision processes between cloud droplets.
Resumo:
The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.
Resumo:
The self-assembly of peptide YYKLVFFC based on a fragment of the amyloid beta (A) peptide, A beta 16-20, KLVFF has been studied in aqueous solution. The peptide is designed with multiple functional residues to examine the interplay between aromatic interactions and charge on the self-assembly, as well as specific transformations such as the pH-induced phenol-phenolate transition of the tyrosine residue. Circular dichroism (CD) and Fourier-transform infrared (FTIR) spectroscopies are used to investigate the conditions for beta-sheet self-assembly and the role of aromatic interactions in the CD spectrum as a function of pH and concentration. The formation of well-defined fibrils at pH 4.7 is confirmed by cryo-TEM (transmission electron microscope) and negative stain TEM. The morphology changes at higher pH, and aggregates of short twisted fibrils are observed at pH 11. Polarized optical microscopy shows birefringence at a low concentration (1 wt.-%) of YYKLVFFC in aqueous solution, and small-angle X-ray scattering was used to probe nematic phase formation in more detail. A pH-induced transition from nematic to isotropic phases is observed on increasing pH that appears to be correlated to a reduction in aggregate anisotropy upon increasing pH.
Resumo:
WThe capillary flow alignment of the thermotropic liquid crystal 4-n-octyl-4′-cyanobiphenyl in the nematic and smectic phases is investigated using time-resolved synchrotron small-angle x-ray scattering. Samples were cooled from the isotropic phase to erase prior orientation. Upon cooling through the nematic phase under Poiseuille flow in a circular capillary, a transition from the alignment of mesogens along the flow direction to the alignment of layers along the flow direction (mesogens perpendicular to flow) appears to occur continuously at the cooling rate applied. The transition is centered on a temperature at which the Leslie viscosity coefficient α3 changes sign. The configuration with layers aligned along the flow direction is also observed in the smectic phase. The transition in the nematic phase on cooling has previously been ascribed to an aligning-nonaligning or tumbling transition. At high flow rates there is evidence for tumbling around an average alignment of layers along the flow direction. At lower flow rates this orientation is more clearly defined. The layer alignment is ascribed to surface-induced ordering propagating into the bulk of the capillary, an observation supported by the parallel alignment of layers observed for a static sample at low temperatures in the nematic phase.
Resumo:
The self-assembly of a fragment of the amyloid beta peptide that has been shown to be critical in amyloid fibrillization has been studied in aqueous solution. There are conflicting reports in the literature on the fibrillization of A beta (16-20), i.e., KLVFF, and our results shed light on this. In dilute solution, self-assembly of NH2-KLVFF-COOH is strongly influenced by aromatic interactions between phenylalanine units, as revealed by UV spectroscopy and circular dichroism. Fourier transform infrared (FTIR) spectroscopy reveals beta-sheet features in spectra taken for more concentrated solutions and also dried films. X-ray diffraction and cryo-transmission electron microscopy (cryo-TEM) provide further support for beta-sheet amyloid fibril formation. A comparison of cryo-TEM images with those from conventional dried and negatively stained TEM specimens highlights the pronounced effects of sample preparation on the morphology. A comparison of FTIR data for samples in solution and dried samples also highlights the strong effect of drying on the self-assembled structure. In more concentrated phosphate-buffered saline (PBS) solution, gelation of NH2-KLVFF-COOH is observed. This is believed to be caused by screening of the electrostatic charge on the peptide, which enables beta sheets to aggregate into a fibrillar gel network. The rheology of the hydrogel is probed, and the structure is investigated by light scattering and small-angle X-ray scattering.
Resumo:
The novel cryptand in/out-3, containing two tripyrrolemethane units briged by three 1,3- diisopropylidenbenzene arms was readily synthesized by a convergent three-step synthesis. It binds fluoride by inclusion with excellent selectivity with respect to a number of other tested anions. The structure of the free receptor and that of its fluoride complex were investigated in solution by NMR spectroscopy. The solid state X-ray structure of the free cryptand 3 was also determined.
Resumo:
A program is provided to determine structural parameters of atoms in or adsorbed on surfaces by refinement of atomistic models towards experimentally determined data generated by the normal incidence X-ray standing wave (NIXSW) technique. The method employs a combination of Differential Evolution Genetic Algorithms and Steepest Descent Line Minimisations to provide a fast, reliable and user friendly tool for experimentalists to interpret complex multidimensional NIXSW data sets.
Resumo:
The lithium salt of the anionic SPS pincer ligand composed of a central hypervalent lambda(4)-phosphinine ring bearing two ortho-positioned diphenylphosphine sulfide side arms reacts with [Mn(CO)(5)Br] to give fac-[Mn(SPS)(CO)(3)], This isomer can be converted photochemicaily to mer-[Mn(SPS)(CO)(3)], with a very high quantum yield (0.80 +/- 0.05). The thermal backreaction is slow (taking ca. 8 h at room temperature), in contrast to rapid electrodecatalyzed mer-to-fac isomerization triggered by electrochemical reduction of mer-[Mn(SPS)(CO)(3)]. Both geometric isomers of [Mn(SPS)(CO)(3)] have been characterized by X-ray crystallography. Both isomers show luminescence from a low-lying (IL)-I-3 (SPS-based) excited state. The light emission of fac-[Mn(SPS)(CO)(3)] is largely quenched by the efficient photoisomerization occurring probably from a low-lying Mn-CO dissociative excited state. Density functional theory (DFT) and time-dependent DFT calculations describe the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) of fac- and mer-[Mn(CO)(3)(SPS)] as ligand-centered orbitals, largely localized on the phosphinine ring of the SPS pincer ligand. In line with the ligand nature of its frontier orbitals, fac-[Mn(SPS)(CO)(3)] is electrochemically reversibly oxidized and reduced to the corresponding radical cation and anion, respectively. The spectroscopic (electron paramagnetic resonance, IR, and UV-vis) characterization of the radical species provides other evidence for the localization of the redox steps on the SIPS ligand. The smaller HOMO-LUMO energy difference in the case of mer-[Mn(CO)(3)(SPS)], reflected in the electronic absorption and emission spectra, corresponds with its lower oxidation potential compared to that of the fac isomer. The thermodynamic instability of mer-[Mn(CO)(3)(SPS)], confirmed by the DFT calculations, increases upon one-electron reduction and oxidation of the complex.
Resumo:
Two vertical cosmic ray telescopes for atmospheric cosmic ray ionization event detection are compared. Counter A, designed for low power remote use, was deployed in the Welsh mountains; its event rate increased with altitude as expected from atmospheric cosmic ray absorption. Independently, Counter B’s event rate was found to vary with incoming particle acceptance angle. Simultaneous colocated comparison of both telescopes exposed to atmospheric ionization showed a linear relationship between their event rates.