Structure, rheology and shear alignment of Pluronic block copolymer mixtures

The structure and flow behaviour of binary mixtures of Pluronic block copolymers P85 and P123 is investigated by small-angle scattering, rheometry and mobility tests. Micelle dimensions are probed by dynamic light scattering. The micelle hydrodynamic radius for the 50/50 mixture is larger than that for either P85 or P123 alone, Clue to the formation of mixed micelles with a higher association number. The phase diagram for 50/50 mixtures contains regions Of Cubic and hexagonal phases similar to those for the parent homopolymers, however the region of stability of the cubic phase is enhanced at low temperature and concentrations above 40 wt%. This is ascribed to favourable packing of the mixed micelles containing core blocks with two different chain lengths, but similar corona chain lengths. The shear flow alignment of face-centred cubic and hexagonal phases is probed by in situ small-angle X-ray or neutron scattering with simultaneous rheology. The hexagonal phase can be aligned using steady shear in a Couette geometry, however the high modulus Cubic phase cannot be aligned well in this way. This requires the application of oscillatory shear or compression. (C) 2008 Elsevier Inc. All rights reserved.

Self-assembly of an amyloid peptide fragment–PEG conjugate: lyotropic phase formation and influence of PEG crystallization

The self-assembly of PEGylated peptides containing a modified sequence from the amyloid beta peptide, YYKLVFF, has been studied in aqueous solution. Two PEG molar masses, PEG1k and PEG3k, were used in the conjugates. It is shown that both YYKLVFF–PEG hybrids form fibrils comprising a peptide core and a PEG corona. The fibrils are much longer for YYKLVFF–PEG1k, pointing to an influence of PEG chain length. The beta-sheet secondary structure of the peptide is retained in the conjugate. Lyotropic liquid crystal phases, specifically nematic and hexagonal columnar phases, are formed at sufficiently high concentration. Flow alignment of these mesophases was investigated by small-angle neutron scattering with in situ steady shearing in a Couette cell. On drying, PEG crystallization occurs leading to characteristic peaks in the X-ray diffraction pattern, and to lamellar structures imaged by atomic force microscopy. The X-ray diffraction pattern retains features of the cross-beta pattern from the beta-sheet structure, showing that this is not disrupted by PEG crystallization.

Self-assembly of PEGylated peptide conjugates containing a modified amyloid β-peptide fragment

The self-assembly of PEGylated peptides containing a modified sequence from the amyloid beta peptide, FEK LVFF, has been studied in aqueous solution. PEG molar masses PEG1k, PEG2k, and PEG10k were used in the conjugates. It is shown that the three FFK LVFF-PEG hybrids form fibrils comprising a FFKLVFF core and a PEG corona. The beta-sheet secondary structure of the peptide is retained in the FFK LVFF fibril core. At sufficiently high concentrations, FEK LVFF-PEG1k and FEK LVFF-PEG2k form a nema tic phase, while PEG10k-FEK LVFF exhibits a hexagonal columnar phase. Simultaneous small angle neutron scattering/shear flow experiments were performed to study the shear flow alignment of the nematic and hexagonal liquid crystal phases. On drying, PEG crystallization occurs without disruption of the FFK LVFF beta-sheet structure leading to characteristic peaks in the X-ray diffraction pattern and FTIR spectra. The stability of beta-sheet structures was also studied in blends of FFKLVFF-PEG conjugates with poly(acrylic acid) (PAA). While PEG crystallization is only observed up to 25% PAA content in the blends, the FFK LVFF beta-sheet structure is retained up to 75% PAA.

Nonspherical assemblies generated from polystyrene-b-poly(L-lysine) polyelectrolyte block copolymers

This report describes the aqueous solution self-assembly of a series of polystyrene(m)-b-poly(L-lysine)n block copolymers (m = 8-10; n = 10-70). The polymers are prepared by ring-opening polymerization of epsilon-benzyloxycarbonyl-L-lysine N-carboxyanhydride using amine terminated polystyrene macroinitiators, followed by removal of the benzyloxycarbonyl side chain protecting groups. The critical micelle concentration of the block copolymers determined using the pyrene probe technique shows a parabolic dependence on peptide block length exhibiting a maximum at n = approximately 20 (m = 8) or n = approximately 60 (m = 10). The shape and size of the aggregates has been studied by dynamic and static light scattering, small-angle neutron scattering (SANS), and analytical ultracentrifugation (AUC). Surprisingly, Holtzer and Kratky analysis of the static light scattering results indicates the presence of nonspherical, presumably cylindrical objects independent of the poly(L-lysine)n block length. This is supported by SANS data, which can be fitted well by assuming cylindrical scattering objects. AUC analysis allows the molecular weight of the aggregates to be estimated as several million g/mol, corresponding to aggregation numbers of several 10s to 100s. These aggregation numbers agree with those that can be estimated from the length and diameter of the cylinders obtained from the scattering results.

Highly asymmetric phase diagram of a poly(1,2-octylene oxide)-poly(ethylene oxide) diblock copolymer system comprising a brush-like poly(1,2-octylene oxide) block

The phase diagram of a series of poly(1,2-octylene oxide)-poly(ethylene oxide) (POO-PEO) diblock copolymers is determined by small-angle X-ray scattering. The Flory-Huggins interaction parameter was measured by small-angle neutron scattering. The phase diagram is highly asymmetric due to large conformational asymmetry that results from the hexyl side chains in the POO block. Non-lamellar phases (hexagonal and gyroid) are observed near f(PEO) = 0.5, and the lamellar phase is observed for f(PEO) >= 0.5.

Chain extension in electrospun polystyrene fibres: a SANS study

Small angle neutron scattering techniques were used to quantify the size and shape of the chain conformation in electrospun fibres of atactic polystyrene prepared from solutions in methyl ethyl ketone. Aligned arrays of fibres were collected onto a rotating collector with tangential velocity varying between 0 ms-1 and approximately 15 ms-1. The measured radii of gyration of the polystyrene chains were found to be slightly higher than that expected for samples prepared from solutions in the concentrated regime. The ratio of the radius of gyration parallel and perpendicular to the chain axis was found to be approximately 1.05 in contrast to the substantial macroscopic shape transformation intrinsic to electrospinning. When the tangential velocity of the rotating collector was greater than the flight velocity of the fibres (ca. 4 ms-1), a further extension of the polymer chains was observed with a ratio of the radii of gyration increasing to 1.20 at the highest collector speeds. It is proposed that the heterogeneous processes involved, particularly solvent evaporation and the formation of a polymer skin during electrospinning play a significant role in determining the level of molecular anisotropy in the fibres.

Puroindoline-a, a lipid binding protein from common wheat, spontaneously forms prolate protein micelles in solution

The self-assembly in solution of puroindoline-a (Pin-a), an amphiphilic lipid binding protein from common wheat, was investigated by small angle neutron scattering, dynamic light scattering and size exclusion chromatography. Pin-a was found to form monodisperse prolate ellipsoidal micelles with a major axial radius of 112 +/- 4.5 A ˚ and minor axial radius of 40.4 +/- 0.18 A ˚ . These protein micelles were formed by the spontaneous self-assembly of 38 Pin-a molecules in solution and were stable over a wide pH range (3.5–11) and at elevated temperatures (20–65 degC). Pin-a micelles could be disrupted upon addition of the non-ionic surfactant dodecyl-b-maltoside, suggesting that the protein self-assembly is driven by hydrophobic forces, consisting of intermolecular interactions between Trp residues located within a well-defined Trp-rich domain of Pin-a.

Liquid crystalline elastomers: the relationship between macroscopic behaviour and the level of backbone anisotropy

Nematic monodomain liquid crystalline elastomers have been prepared through in situ cross-linking of an acrylate based side-chain liquid crystalline polymer in a magnetic field. At the nematic–isotropic transition, the sample is found to undergo an anisotropic shape change. There is found to be an increase in dimensions perpendicular — and a decrease parallel — to the director, this is consistent with alignment of the polymer backbone parallel to the direction of mesogen alignment in the nematic state. From a quantitative investigation of this behaviour, we estimate the level of backbone anisotropy for the elastomer. As second measure of the backbone anisotropy, the monodomain sample was physically extended. We have investigated, in particular, the situation where a monodomain sample is deformed with the angle between the director and the extension direction approaching 90°. The behaviour on extension of these acrylate samples is related to alternative theoretical interpretations and the backbone anisotropy determined. Comparison of the chain anisotropy derived from these two approaches and the value obtained from previous small-angle neutron scattering measurements on deuterium labelled mixtures of the same polymer shows that some level of chain anisotropy is retained in the isotropic or more strictly weakly paranematic state of the elastomer. The origin and implications of this behaviour are discussed.

Coupling between mesogenic units and polymer backbone in side-chain liquid crystal polymers and elastomers

The levels of alignment of the mesogenic units and of the polymer backbone trajectory for polyacrylate based nematic side-chain liquid crystal polymers and elastomers were evaluated by using wide angle X-ray and small angle neutron scattering procedures. The X-ray scattering measurements show that substantial levels of preferred orientation of the mesogenic units may be introduced through magnetic fields for uncrosslinked polymers and through mechanical extension for liquid crystal elastomers. Small angle neutron scattering measurements show that for highly aligned samples an anisotropic polymer backbone trajectory is observed in which the envelope is slightly extended by ∼ 10% in the direction parallel to the axis of alignment of the mesogenic units. The sense of this coupling differs from that recorded for other uncrosslinked side-chain liquid crystal polymers. Possible mechanisms to account for this anisotropy and its relationship to the properties of liquid crystal elastomers are discussed. The observed deformation behaviour of the liquid crystal elastomer is non-affine and this appears to confirm the dominating influence of the liquid crystal order of the side chains on the mechanical properties of these novel networks.

A single director switching mode for monodomain liquid crystal elastomer

We report rotation of a single director in a nematic monodomain, acrylate based side-chain elastomer which was subjected to mechanical fields applied at angles in the range to the director, , present at the time of network formation. Time and spatially resolving wide angle X-ray scattering, together with polarised light microscopy measurements revealed a pronounced, almost discontinuous switching mode at a critical extension as the strain was applied at angles approaching to , whereas a more continuous rotation was seen when the strain was applied at more acute angles. This director reorientation was more or less uniform across the complete sample and was accompanied by a modest decrease in orientation parameter . At strains sufficient to induce switching there was some continuous distribution of director orientations with fluctuations of 10 although there was no evidence for any localised director inhomogenities such as domain formation. The observed deformation behaviour of these acrylate-based nematic monodomains was in accord with the predictions of a theory developed by Bladon et al., in that the complete set of data could be accounted for through a single parameter describing the chain anisotropy. The experimentally deduced chain anisotropy parameter was in broad agreement with that obtained from small-angle neutron scattering procedures, but was somewhat greater than that obtained by spontaneous shape changes at the nematic-isotropic transition.

Chapter 16: Electrospinning of polymer solutions

Electrospinning is a technique that involves the production of nanoscale to microscale sized polymer fibres through the application of an electric field to a droplet of polymer solution passed through a spinneret tip. This chapter considers the optimisisation of the electrospinning process and in particular the variation with solution concentration. We show the strong connection between overlapping chains and the successful spinning of fibres. We use small-angle neutron scattering to evaluate the molecular conformations in the solutions and in the fibres.

On the role of specific interactions in the diffusion of nanoparticles in aqueous polymer solutions

Understanding nanoparticle diffusion within non-Newtonian biological and synthetic fluids is essential in designing novel formulations (e.g., nanomedicines for drug delivery, shampoos, lotions, coatings, paints, etc.), but is presently poorly defined. This study reports the diffusion of thiolated and PEGylated silica nanoparticles, characterized by small-angle neutron scattering, in solutions of various water-soluble polymers such as poly(acrylic acid) (PAA), poly(Nvinylpyrrolidone) (PVP), poly(ethylene oxide) (PEO), and hydroxyethylcellulose (HEC) probed using NanoSight nanoparticle tracking analysis. Results show that the diffusivity of nanoparticles is affected by their dimensions, medium viscosity, and, in particular, the specific interactions between nanoparticles and the macromolecules in solution; strong attractive interactions such as hydrogen bonding hamper diffusion. The water-soluble polymers retarded the diffusion of thiolated particles in the order PEO > PVP > PAA > HEC whereas for PEGylated silica particles retardation followed the order PAA > PVP = HEC > PEO. In the absence of specific interactions with the medium, PEGylated nanoparticles exhibit enhanced mobility compared to their thiolated counterparts despite some increase in their dimensions.

Experimentally driven atomistic model of 1,2 Polybutadiene

We present an efficient method of combining wide angle neutron scattering data with detailed atomistic models, allowing us to perform a quantitative and qualitative mapping of the organisation of the chain conformation in both glass and liquid phases. The structural refinement method presented in this work is based on the exploitation of the intrachain features of the diffraction pattern and its intimate linkage with atomistic models by the use of internal coordinates for bond lengths, valence angles and torsion rotations. Atomic connectivity is defined through these coordinates that are in turn assigned by pre-defined probability distributions, thus allowing for the models in question to be built stochastically. Incremental variation of these coordinates allows for the construction of models that minimise the differences between the observed and calculated structure factors. We present a series of neutron scattering data of 1,2 polybutadiene at the region 120-400K. Analysis of the experimental data yield bond lengths for C-C and C=C of 1.54Å and 1.35Å respectively. Valence angles of the backbone were found to be at 112° and the torsion distributions are characterised by five rotational states, a three-fold trans-skew± for the backbone and gauche± for the vinyl group. Rotational states of the vinyl group were found to be equally populated, indicating a largely atactic chan. The two backbone torsion angles exhibit different behaviour with respect to temperature of their trans population, with one of them adopting an almost all trans sequence. Consequently the resulting configuration leads to a rather persistent chain, something indicated by the value of the characteristic ratio extrapolated from the model. We compare our results with theoretical predictions, computer simulations, RIS models and previously reported experimental results.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.