Minimum neighborhood in a generalized cube

Generalized cubes are a subclass of hypercube-like networks, which include some hypercube variants as special cases. Let theta(G)(k) denote the minimum number of nodes adjacent to a set of k vertices of a graph G. In this paper, we prove theta(G)(k) >= -1/2k(2) + (2n - 3/2)k - (n(2) - 2) for each n-dimensional generalized cube and each integer k satisfying n + 2 <= k <= 2n. Our result is an extension of a result presented by Fan and Lin [J. Fan, X. Lin, The t/k-diagnosability of the BC graphs, IEEE Trans. Comput. 54 (2) (2005) 176-184]. (c) 2005 Elsevier B.V. All rights reserved.

Generalized honeycomb torus is Hamiltonian

Generalized honeycomb torus is a candidate for interconnection network architectures, which includes honeycomb torus, honeycomb rectangular torus, and honeycomb parallelogramic torus as special cases. Existence of Hamiltonian cycle is a basic requirement for interconnection networks since it helps map a "token ring" parallel algorithm onto the associated network in an efficient way. Cho and Hsu [Inform. Process. Lett. 86 (4) (2003) 185-190] speculated that every generalized honeycomb torus is Hamiltonian. In this paper, we have proved this conjecture. (C) 2004 Elsevier B.V. All rights reserved.

A lower bound on the size of k-neighborhood in generalized cubes

The determination of the minimum size of a k-neighborhood (i.e., a neighborhood of a set of k nodes) in a given graph is essential in the analysis of diagnosability and fault tolerance of multicomputer systems. The generalized cubes include the hypercube and most hypercube variants as special cases. In this paper, we present a lower bound on the size of a k-neighborhood in n-dimensional generalized cubes, where 2n + 1 <= k <= 3n - 2. This lower bound is tight in that it is met by the n-dimensional hypercube. Our result is an extension of two previously known results. (c) 2005 Elsevier Inc. All rights reserved.

A novel radix-3/9 algorithm for type-III generalized discrete Hartley transform

A novel radix-3/9 algorithm for type-III generalized discrete Hartley transform (GDHT) is proposed, which applies to length-3(P) sequences. This algorithm is especially efficient in the case that multiplication is much more time-consuming than addition. A comparison analysis shows that the proposed algorithm outperforms a known algorithm when one multiplication is more time-consuming than five additions. When combined with any known radix-2 type-III GDHT algorithm, the new algorithm also applies to length-2(q)3(P) sequences.

Approximate Riemann solutions of the two-dimensional shallow-water equations

A finite-difference scheme based on flux difference splitting is presented for the solution of the two-dimensional shallow-water equations of ideal fluid flow. A linearised problem, analogous to that of Riemann for gasdynamics, is defined and a scheme, based on numerical characteristic decomposition, is presented for obtaining approximate solutions to the linearised problem. The method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second-order scheme which avoids non-physical, spurious oscillations. An extension to the two-dimensional equations with source terms, is included. The scheme is applied to a dam-break problem with cylindrical symmetry.

Similarity solutions of the shallow water equations

A one-dimensional shock (bore) reflection problem is discussed for the two-dimensional shallow water equations with cylindrical symmetry. The differential equations for a similarity solution are derived and solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Solutions of a two-dimensional dam-break problem

Solutions of a two-dimensional dam break problem are presented for two tailwater/reservoir height ratios. The numerical scheme used is an extension of one previously given by the author [J. Hyd. Res. 26(3), 293–306 (1988)], and is based on numerical characteristic decomposition. Thus approximate solutions are obtained via linearised problems, and the method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second order scheme which avoids non-physical, spurious oscillations.

Similarity solutions for multicomponent flows

A one-dimensional shock-reflection test problem in the case of slab, cylindrical or spherical symmetry is discussed for multi-component flows. The differential equations for a similarity solution are derived and then solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Thermodynamics of climate change: generalized sensitivities

Using a recent theoretical approach, we study how global warming impacts the thermodynamics of the climate system by performing experiments with a simplified yet Earth-like climate model. The intensity of the Lorenz energy cycle, the Carnot efficiency, the material entropy production, and the degree of irreversibility of the system change monotonically with the CO2 concentration. Moreover, these quantities feature an approximately linear behaviour with respect to the logarithm of the CO2 concentration in a relatively wide range. These generalized sensitivities suggest that the climate becomes less efficient, more irreversible, and features higher entropy production as it becomes warmer, with changes in the latent heat fluxes playing a predominant role. These results may be of help for explaining recent findings obtained with state of the art climate models regarding how increases in CO2 concentration impact the vertical stratification of the tropical and extratropical atmosphere and the position of the storm tracks.

The implications of service-dominant logic and integrated solutions on the sales function

This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.

Anticipatory activation in the amygdala and anterior cingulate in generalized anxiety disorder and prediction of treatment response

OBJECTIVE: The anticipation of adverse outcomes, or worry, is a cardinal symptom of generalized anxiety disorder. Prior work with healthy subjects has shown that anticipating aversive events recruits a network of brain regions, including the amygdala and anterior cingulate cortex. This study tested whether patients with generalized anxiety disorder have alterations in anticipatory amygdala function and whether anticipatory activity in the anterior cingulate cortex predicts treatment response. METHOD: Functional magnetic resonance imaging (fMRI) was employed with 14 generalized anxiety disorder patients and 12 healthy comparison subjects matched for age, sex, and education. The event-related fMRI paradigm was composed of one warning cue that preceded aversive pictures and a second cue that preceded neutral pictures. Following the fMRI session, patients received 8 weeks of treatment with extended-release venlafaxine. RESULTS: Patients with generalized anxiety disorder showed greater anticipatory activity than healthy comparison subjects in the bilateral dorsal amygdala preceding both aversive and neutral pictures. Building on prior reports of pretreatment anterior cingulate cortex activity predicting treatment response, anticipatory activity in that area was associated with clinical outcome 8 weeks later following treatment with venlafaxine. Higher levels of pretreatment anterior cingulate cortex activity in anticipation of both aversive and neutral pictures were associated with greater reductions in anxiety and worry symptoms. CONCLUSIONS: These findings of heightened and indiscriminate amygdala responses to anticipatory signals in generalized anxiety disorder and of anterior cingulate cortex associations with treatment response provide neurobiological support for the role of anticipatory processes in the pathophysiology of generalized anxiety disorder.

A geometric approach to generalized Stokes conjectures

We consider the Stokes conjecture concerning the shape of extreme two-dimensional water waves. By new geometric methods including a nonlinear frequency formula, we prove the Stokes conjecture in the original variables. Our results do not rely on structural assumptions needed in previous results such as isolated singularities, symmetry and monotonicity. Part of our results extends to the mathematical problem in higher dimensions.

A neural network enhanced generalized minimum variance self-tuning proportional, integral and derivative control algorithm for complex dynamic systems

A neural network enhanced proportional, integral and derivative (PID) controller is presented that combines the attributes of neural network learning with a generalized minimum-variance self-tuning control (STC) strategy. The neuro PID controller is structured with plant model identification and PID parameter tuning. The plants to be controlled are approximated by an equivalent model composed of a simple linear submodel to approximate plant dynamics around operating points, plus an error agent to accommodate the errors induced by linear submodel inaccuracy due to non-linearities and other complexities. A generalized recursive least-squares algorithm is used to identify the linear submodel, and a layered neural network is used to detect the error agent in which the weights are updated on the basis of the error between the plant output and the output from the linear submodel. The procedure for controller design is based on the equivalent model, and therefore the error agent is naturally functioned within the control law. In this way the controller can deal not only with a wide range of linear dynamic plants but also with those complex plants characterized by severe non-linearity, uncertainties and non-minimum phase behaviours. Two simulation studies are provided to demonstrate the effectiveness of the controller design procedure.