111 resultados para X-RAY CRYSTAL


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A series of hexadentate ligands, H2Lm (m = 1−4), [1H-pyrrol-2-ylmethylene]{2-[2-(2-{[1H-pyrrol-2-ylmethylene]amino}phenoxy)ethoxy]phenyl}amine (H2L1), [1H-pyrrol-2-ylmethylene]{2-[4-(2-{[1H-pyrrol-2-ylmethylene]amino}phenoxy)butoxy]phenyl}amine (H2L2), [1H-pyrrol-2-ylmethylene][2-({2-[(2-{[1H-pyrrol-2-ylmethylene]amino}phenyl)thio]ethyl}thio)phenyl]amine (H2L3) and [1H-pyrrol-2-ylmethylene][2-({4-[(2-{[1H-pyrrol-2-lmethylene]amino}phenyl)thio]butyl}thio) phenyl]amine (H2L4) were prepared by condensation reaction of pyrrol-2-carboxaldehyde with {2-[2-(2-aminophenoxy)ethoxy]phenyl}amine, {2-[4-(2-aminophenoxy)butoxy]phenyl}amine, [2-({2-[(2-aminophenyl)thio]ethyl}thio)phenyl]amine and [2-({4-[(2-aminophenyl)thio]butyl}thio)phenyl]amine respectively. Reaction of these ligands with nickel(II) and copper(II) acetate gave complexes of the form MLm (m = 1−4), and the synthesized ligands and their complexes have been characterized by a variety of physico-chemical techniques. The solid and solution states investigations show that the complexes are neutral. The molecular structures of NiL3 and CuL2, which have been determined by single crystal X-ray diffraction, indicate that the NiL3 complex has a distorted octahedral coordination environment around the metal while the CuL2 complex has a seesaw coordination geometry. DFT calculations were used to analyse the electronic structure and simulation of the electronic absorption spectrum of the CuL2 complex using TDDFT gives results that are consistent with the measured spectroscopic behavior of the complex. Cyclic voltammetry indicates that all copper complexes are electrochemically inactive but the nickel complexes with softer thioethers are more easily oxidized than their oxygen analogs.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The addition of the atropisomeric racemic sulfur compound 4,4′-biphenanthrene-3,3′-dithiol (H2 biphes) to a dichloromethane solution of [{M(μ-OMe)(cod)}2] (M = Rh, Ir, cod = cycloocta-1,5-diene) afforded the dithiolate-bridged complexes [{Rh2(μ-biphes)(cod)2}n] (n = 2 5 or n = 1 6) and [{Ir2(μ-biphes)(cod)2}n]·nCH2Cl27. When 1,1′-binaphthalene-2,2′-dithiol (H2 binas) reacted with [{Ir(μ-OMe)(cod)}2], complex [Ir2(μ-binas)(cod)2] 8 was obtained. Complexes 5 and 6 reacted with carbon monoxide to give the dinuclear tetracarbonyl complex [Rh2(μ-biphes)(CO)4] 9. The reaction of 9 with PR3 provided the mixed-ligand complexes [{Rh2(μ-biphes)(CO)2(PR3)2}2] · xCH2Cl2 (R = Ph, x = 2 10, C6H11, x = 1 11) and [{Rh2(μ-biphes)(CO)3(PR3)}2] · CH2Cl212 (R = OC6H4But-o). The crystal structure of 6 was determined by X-ray diffraction. Reaction of the dithioether ligand Me2biphes with [Rh(cod)2]ClO4 in CH2Cl2 solution afforded the cationic complex [Rh(cod)(Me2biphes)]ClO4 · CH2Cl213. Asymmetric hydroformylation of styrene was performed using the complexes described. The extent of aldehyde conversion ranges from 53 to 100%, with selectivities towards branched aldehydes in the range 51 to 96%. The enantioselectivities were quite low and did not exceed 20%.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The solubility of penciclovir (C10N5O3H17) in a novel film formulation designed for the treatment of cold sores was determined using X-ray, thermal, microscopic and release rate techniques. Solubilities of 0.15–0.23, 0.44, 0.53 and 0.42% (w/w) resulted for each procedure. Linear calibration lines were achieved for experimentally and theoretically determined differential scanning calorimetry (DSC) and X-ray powder diffractometry (XRPD) data. Intra- and inter-batch data precision values were determined; intra values were more precise. Microscopy was additionally useful for examining crystal shape, size distribution and homogeneity of drug distribution within the film. Whereas DSC also determined melting point, XRPD identified polymorphs and release data provided relevant kinetics.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Naphthalene and anthracene transition metalates are potent reagents, but their electronic structures have remained poorly explored. A study of four Cp*-substituted iron complexes (Cp* = pentamethylcyclopentadienyl) now gives rare insight into the bonding features of such species. The highly oxygen- and water-sensitive compounds [K(18-crown- 6){Cp*Fe(η4-C10H8)}] (K1), [K(18-crown-6){Cp*Fe(η4-C14H10)}] (K2), [Cp*Fe(η4-C10H8)] (1), and [Cp*Fe(η4-C14H10)] (2) were synthesized and characterized by NMR, UV−vis, and 57Fe Mössbauer spectroscopy. The paramagnetic complexes 1 and 2 were additionally characterized by electron paramagnetic resonance (EPR) spectroscopy and magnetic susceptibility measurements. The molecular structures of complexes K1, K2, and 2 were determined by single-crystal X-ray crystallography. Cyclic voltammetry of 1 and 2 and spectroelectrochemical experiments revealed the redox properties of these complexes, which are reversibly reduced to the monoanions [Cp*Fe(η4-C10H8)]− (1−) and [Cp*Fe(η4-C14H10)]− (2−) and reversibly oxidized to the cations [Cp*Fe(η6-C10H8)]+ (1+) and [Cp*Fe(η6-C14H10)]+ (2+). Reduced orbital charges and spin densities of the naphthalene complexes 1−/0/+ and the anthracene derivatives 2−/0/+ were obtained by density functional theory (DFT) methods. Analysis of these data suggests that the electronic structures of the anions 1− and 2− are best represented by low-spin FeII ions coordinated by anionic Cp* and dianionic naphthalene and anthracene ligands. The electronic structures of the neutral complexes 1 and 2 may be described by a superposition of two resonance configurations which, on the one hand, involve a low-spin FeI ion coordinated by the neutral naphthalene or anthracene ligand L, and, on the other hand, a low-spin FeII ion coordinated to a ligand radical L•−. Our study thus reveals the redox noninnocent character of the naphthalene and anthracene ligands, which effectively stabilize the iron atoms in a low formal, but significantly higher spectroscopic oxidation state.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

ray micro-tomography is a well-established technique for non-invasive imaging and evaluation of heterogeneous materials. An inexpensive X-ray micro-tomography system has been designed and built for the specific purposes of examining root growth and root/soil interactions. The system uses a silver target X-ray source with a focal spot diameter of 80 mum, an X-ray image intensifier with a sampling aperture of about 100 mum, and a sample with a diameter of 25 mm. Pre-germinated wheat and rape seeds were grown for up to 8-10 days in plastic containers in a sandy loam soil sieved to < 250 μm, and imaged with the X-ray system at regular intervals. The quality of 3 D image obtained was good allowing the development and growth of both root axes and some first-order laterals to be observed. The satisfactory discrimination between soil and roots enabled measurements of root diameter (wheat values were 0.48-1.22 mm) in individual tomographic slices and, by tracking from slice to slice, root lengths were also measured. The measurements obtained were generally within 10% of those obtained from destructive samples measured manually and with a flat-bed scanner. Further developments of the system will allow more detailed examination of the root: soil interface.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Root characteristics of seedlings of five different barley genotypes were analysed in 2D using gel chambers, and in 3D using soil sacs that were destructively harvested and pots of soil that were assessed non-invasively using X-ray microtomography. After 5 days, Chime produced the greatest number of root axes (similar to 6) and Mehola significantly less (similar to 4) in all growing methods. Total root length was longest in GSH01915 and shortest in Mehola for all methods, but both total length and average root diameter were significantly larger for plants grown in gel chambers than those grown in soil. The ranking of particular growth traits (root number, root angular spread) of plants grown in gel plates, soil sacs and X-ray pots was similar, but plants grown in the gel chambers had a different order of ranking for root length to the soil-grown plants. Analysis of angles in soil-grown plants showed that Tadmore had the most even spread of individual roots and Chime had a propensity for non-uniform distribution and root clumping. The roots of Mehola were less well spread than the barley cultivars supporting the suggestion that wild and landrace barleys tend to have a narrower angular spread than modern cultivars. The three dimensional analysis of root systems carried out in this study provides insights into the limitations of screening methods for root traits and useful data for modelling root architecture.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

An X-ray micro-tomography system has been designed that is dedicated to the low-dose imaging of radiation sensitive living organisms and has been used to image the early development of the first few days of plant development immediately after germination. The system is based on third-generation X-ray micro-tomography system and consists of an X-ray tube, two-dimensional X-ray detector and a mechanical sample manipulation stage. The X-ray source is a 50 kVp X-ray tube with a silver target with a filter to centre the X-ray spectrum on 22 keV.A 100 mm diameter X-ray image intensifier (XRII) is used to collect the two-dimensional projection images. The rotation tomography table incorporates a linear translation mechanism to eliminate ring artefact that is commonly associated with third-generation tomography systems' Developing maize seeds (Triticum aestivum) have been imaged using the system with a cubic voxel linear dimension of 100 mum, over a diameter of 25 mm and the root lengths and volumes measured. The X-ray dose to the plants was also assessed and found to have no effect on the plant root development. (C) 2003 Elsevier Science Ltd. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

1. In contrast to above-ground insects, comparatively little is known about the behaviour of subterranean insects, due largely to the difficulty of studying them in situ. 2. The movement of newly hatched (neonate) clover root weevil (Sitona lepidus L. Coleoptera: Curculinidae) larvae was studied non-invasively using recently developed high resolution X-ray microtomography. 3. The movement and final position of S. lepidus larvae in the soil was reliably established using X-ray microtomography, when compared with larval positions that were determined by destructively sectioning the soil column. 4. Newly hatched S. lepidus larvae were seen to attack the root rhizobial nodules of their host plant, white clover (Trifolium repens L.). Sitona lepidus larvae travelled between 9 and 27 mm in 9 h at a mean speed of 1.8 mm h(-1). 5. Sitona lepidus larvae did not move through the soil in a linear manner, but changed trajectory in both the lateral and vertical planes.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The oxalate oxidase enzyme expressed in barley roots is a thermostable, protease-resistant enzyme that generates H2O2. It has great medical importance because of its use to assay plasma and urinary oxalate, and it has also been used to generate transgenic, pathogen-resistant crops. This protein has now been purified and three types of crystals grown. X-ray analysis shows that the symmetry present in these crystals is consistent with a hexameric arrangement of subunits, probably a trimer of dimers. This structure may be similar to that found in the related seed storage proteins.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The yncE gene of Escherichia coli encodes a predicted periplasmic protein of unknown function. The gene is de-repressed under iron restriction through the action of the global iron regulator Fur. This suggests a role in iron acquisition, which is supported by the presence of the adjacent yncD gene encoding a potential TonB-dependent outer-membrane transporter. Here, the preliminary crystallographic structure of YncE is reported, revealing that it consists of a seven-bladed beta-propeller which resembles the corresponding domain of the `surface-layer protein' of Methanosarcina mazei. A full structure determination is under way in order to provide insight into the function of this protein.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

YcdB is a periplasmic haem-containing protein from Escherichia coli that has a potential role in iron transport. It is currently the only reported haem-containing Tat-secreted substrate. Here, the overexpression, purification, crystallization and structure determination at 2.0 angstrom resolution are reported for the apo form of the protein. The apo-YcdB structure resembles those of members of the haem-dependent peroxidase family and thus confirms that YcdB is also a member of this family. Haem-soaking experiments with preformed apo-YcdB crystals have been optimized to successfully generate haem-containing YcdB crystals that diffract to 2.9 angstrom. Completion of model building and structure refinement are under way.