117 resultados para OLIGONUCLEOTIDE ARRAYS
Resumo:
Children with autistic spectrum disorders (ASDs) tend to suffer from severe gastrointestinal problems. Such symptoms may be due to a disruption of the indigenous gut flora promoting the overgrowth of potentially pathogenic micro-organisms. The faecal flora of patients with ASDs was studied and compared with those of two control groups (healthy siblings and unrelated healthy children). Faecal bacterial populations were assessed through the use of a culture-independent technique, fluorescence in situ hybridization, using oligonucleotide probes targeting predominant components of the gut flora. The faecal flora of ASD patients contained a higher incidence of the Clostridium histolyticum group (Clostridium clusters I and 11) of bacteria than that of healthy children. However, the non-autistic sibling group had an intermediate level of the C. histolyticum group, which was not significantly different from either of the other subject groups. Members of the C. histolyticum group are recognized toxin-producers and may contribute towards gut dysfunction, with their metabolic products also exerting systemic effects. Strategies to reduce clostridial population levels harboured by ASD patients or to improve their gut microflora profile through dietary modulation may help to alleviate gut disorders common in such patients.
Resumo:
The recent discovery that vitamin E (VE) regulates gene activity at the transcriptional level indicates that VE may exert part of its biological effects by mechanisms which may be independent of its well-recognised antioxidant function. The objective of this study was the identification of hepatic vitamin E-sensitive genes and examination of the effects of VE on their corresponding biological endpoints. Two groups of male rats were randomly assigned to either a VE-sufficient diet or to a control diet deficient in VE for 290 days. High-density oligonucleotide microarrays comprising over 7000 genes were used to assess the transcriptional response of the liver. Differential gene expression was monitored over a period of 9 months, at four different time-points, and rats were individually profiled. This experimental strategy identified several VE-sensitive genes, which were chronically altered by dietary VE. VE supplementation down-regulated scavenger receptor CD36, coagulation factor IX and 5-alpha-steroid reductase type 1 mRNA levels while hepatic gamma glutamyl-cysteinyl synthetase was significantly up-regulated. Measurement of the corresponding biological endpoints such as activated partial thromboplastin time, plasma dihydrotestosterone and hepatic glutathione substantiated the gene chip data which indicated that dietary VE plays an important role in a range of metabolic processes within the liver. (C) 2004 Elsevier B.V. All rights reserved.
Resumo:
An important step in liposome characterization is to determine the location of a drug within the liposome. This work thus investigated the interaction of dipalmitoylphosphatidylcholine liposomes with drugs of varied water solubility, polar surface area (PSA) and partition coefficient using high sensitivity differential scanning calorimetry. Lipophilic estradiol (ES) interacted strongest with the acyl chains of the lipid membrane, followed by the somewhat polar 5-fluorouracil (5-FU). Strongly hydrophilic mannitol (MAN) showed no evidence of interaction but water soluble polymers inulin (IN) and an antisense oligonucleotide (OLG), which have very high PSAs, interacted with the lipid head groups. Accordingly, the drugs could be classified as: hydrophilic ones situated in the aqueous core and which may interact with the head groups; those located at the water-bilayer interface with some degree of penetration into the lipid bilayer; those lipophilic drugs constrained within the bilayer. (c) 2004 Elsevier B.V. All rights reserved.
Resumo:
The acute hippocampal brain slice preparation is an important in vitro screening tool for potential anticonvulsants. Application of 4-aminopyridine (4-AP) or removal of external Mg2+ ions induces epileptiform bursting in slices which is analogous to electrical brain activity seen in status epilepticus states. We have developed these epileptiform models for use with multi-electrode arrays (MEAs), allowing recording across the hippocampal slice surface from 59 points. We present validation of this novel approach and analyses using two anticonvulsants, felbamate and phenobarbital, the effects of which have already been assessed in these models using conventional extracellular recordings. In addition to assessing drug effects on commonly described parameters (duration, amplitude and frequency), we describe novel methods using the MEA to assess burst propagation speeds and the underlying frequencies that contribute to the epileptiform activity seen. Contour plots are also used as a method of illustrating burst activity. Finally, we describe hitherto unreported properties of epileptiform, bursting induced by 100 mu M 4-AP or removal of external Mg2+ ions. Specifically, we observed decreases over time in burst amplitude and increase over time in burst frequency in the absence of additional pharmacological interventions. These MEA methods enhance the depth, quality and range of data that can be derived from the hippocampal slice preparation compared to conventional extracellular recordings. it may also uncover additional modes of action that contribute to anti-epileptiform drug effects. (C) 2009 Elsevier B.V. All rights reserved.
Resumo:
Pullpipelining, a pipeline technique where data is pulled from successor stages from predecessor stages is proposed Control circuits using a synchronous, a semi-synchronous and an asynchronous approach are given. Simulation examples for a DLX generic RISC datapath show that common control pipeline circuit overhead is avoided using the proposal. Applications to linear systolic arrays in cases when computation is finished at early stages in the array are foreseen. This would allow run-time data-driven digital frequency modulation of synchronous pipelined designs. This has applications to implement algorithms exhibiting average-case processing time using a synchronous approach.
Resumo:
An approach to the automatic generation of efficient Field Programmable Gate Arrays (FPGAs) circuits for the Regular Expression-based (RegEx) Pattern Matching problems is presented. Using a novel design strategy, as proposed, circuits that are highly area-and-time-efficient can be automatically generated for arbitrary sets of regular expressions. This makes the technique suitable for applications that must handle very large sets of patterns at high speed, such as in the network security and intrusion detection application domains. We have combined several existing techniques to optimise our solution for such domains and proposed the way the whole process of dynamic generation of FPGAs for RegEX pattern matching could be automated efficiently.
Synapsing variable length crossover: An algorithm for crossing and comparing variable length genomes
Resumo:
The Synapsing Variable Length Crossover (SVLC) algorithm provides a biologically inspired method for performing meaningful crossover between variable length genomes. In addition to providing a rationale for variable length crossover it also provides a genotypic similarity metric for variable length genomes enabling standard niche formation techniques to be used with variable length genomes. Unlike other variable length crossover techniques which consider genomes to be rigid inflexible arrays and where some or all of the crossover points are randomly selected, the SVLC algorithm considers genomes to be flexible and chooses non-random crossover points based on the common parental sequence similarity. The SVLC Algorithm recurrently "glues" or synapses homogenous genetic sub-sequences together. This is done in such a way that common parental sequences are automatically preserved in the offspring with only the genetic differences being exchanged or removed, independent of the length of such differences. In a variable length test problem the SVLC algorithm is shown to outperform current variable length crossover techniques. The SVLC algorithm is also shown to work in a more realistic robot neural network controller evolution application.
Resumo:
The synapsing variable-length crossover (SVLC algorithm provides a biologically inspired method for performing meaningful crossover between variable-length genomes. In addition to providing a rationale for variable-length crossover, it also provides a genotypic similarity metric for variable-length genomes, enabling standard niche formation techniques to be used with variable-length genomes. Unlike other variable-length crossover techniques which consider genomes to be rigid inflexible arrays and where some or all of the crossover points are randomly selected, the SVLC algorithm considers genomes to be flexible and chooses non-random crossover points based on the common parental sequence similarity. The SVLC algorithm recurrently "glues" or synapses homogenous genetic subsequences together. This is done in such a way that common parental sequences are automatically preserved in the offspring with only the genetic differences being exchanged or removed, independent of the length of such differences. In a variable-length test problem, the SVLC algorithm compares favorably with current variable-length crossover techniques. The variable-length approach is further advocated by demonstrating how a variable-length genetic algorithm (GA) can obtain a high fitness solution in fewer iterations than a traditional fixed-length GA in a two-dimensional vector approximation task.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
This paper is concerned with the uniformization of a system of afine recurrence equations. This transformation is used in the design (or compilation) of highly parallel embedded systems (VLSI systolic arrays, signal processing filters, etc.). In this paper, we present and implement an automatic system to achieve uniformization of systems of afine recurrence equations. We unify the results from many earlier papers, develop some theoretical extensions, and then propose effective uniformization algorithms. Our results can be used in any high level synthesis tool based on polyhedral representation of nested loop computations.
Resumo:
The paper is concerned with the uniformization of a system of affine recurrence equations. This transformation is used in the design (or compilation) of highly parallel embedded systems (VLSI systolic arrays, signal processing filters, etc.). We present and implement an automatic system to achieve uniformization of systems of affine recurrence equations. We unify the results from many earlier papers, develop some theoretical extensions, and then propose effective uniformization algorithms. Our results can be used in any high level synthesis tool based on polyhedral representation of nested loop computations.
Resumo:
We present a novel approach to calculating Low-Energy Electron Diffraction (LEED) intensities for ordered molecular adsorbates. First, the intra-molecular multiple scattering is computed to obtain a non-diagonal molecular T-matrix. This is then used to represent the entire molecule as a single scattering object in a conventional LEED calculation, where the Layer Doubling technique is applied to assemble the different layers, including the molecular ones. A detailed comparison with conventional layer-type LEED calculations is provided to ascertain the accuracy of this scheme of calculation. Advantages of this scheme for problems involving ordered arrays of molecules adsorbed on surfaces are discussed.
Resumo:
Inverse bicontinuous cubic (Q(II)) phases are nanostructured materials formed by lipid self-assembly. We have successfully imaged thin films of hydrated Q(II) phases from two different systems using AFM. The images show periodic arrays of water channels with spacing and symmetry consistent with published SAXS data on the bulk materials.