123 resultados para NEUTRON-RICH NUCLEI


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Consumption of oily fish and fish oils is associated with protection against cardiovascular disease. Paradoxically, long-chain polyunsaturated fatty acids present in low-density lipoprotein (LDL) are suggested to be susceptible to oxidation. It is not clear whether eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have similar effects on the susceptibility of LDL to oxidation or whether they affect the thrombogenicity of oxidized LDL. This study examined the influence of highly purified preparations of EPA and DHA on LDL oxidizability and LDL-supported thrombin generation in healthy human volunteers. Forty-two healthy volunteers were randomly assigned to receive olive oil (placebo), an EPA-rich oil or a DHA-rich oil for 4 weeks at a dose of 9 g oil/day. EPA and DHA were incorporated into LDL phospholipids and cholesteryl esters during the supplementation period, but were progressively lost during ex vivo copper-mediated oxidation. Following supplementation, the EPA treatment significantly increased the formation of conjugated dienes during LDL oxidation compared with baseline, whereas the DHA treatment had no effect. Neither treatment significantly affected the lag time for oxidation, oxidation rate during the propagation phase or maximum diene production. Neither EPA nor DHA significantly affected the thrombotic tendency of oxidized LDL compared with the placebo, although DHA tended to decrease it. In conclusion, there are subtle differences in the effects of EPA and DHA on the oxidizability and thrombogenicity of LDL. DHA does not appear to increase the susceptibility of LDL to oxidation to the same degree as EPA and has a tendency to decrease LDL-supported thrombin generation. (C) 2004 Elsevier Ireland Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The prebiotic effect of a pectic oligosaccharide-rich extract enzymatically derived from bergamot peel was studied using pure and mixed cultures of human faecal bacteria. This was compared to the prebiotic effect of fructo-oligosaccharides (FOS). Individual species of bifidobacteria and lactobacilli responded positively to the addition of the bergamot extract, which contained oligosaccharides in the range of three to seven. Fermentation studies were also carried out in controlled pH batch mixed human faecal cultures and changes in gut bacterial groups were monitored over 24 h by fluorescent in situ hybridisation, a culture-independent microbial assessment. Addition of the bergamot oligosaccharides (BOS) resulted in a high increase in the number of bifidobacteria and lactobacilli, whereas the clostridial population decreased. A prebiotic index (PI) was calculated for both FOS and BOS after 10 and 24 h incubation. Generally, higher PI scores were obtained after 10 h incubation, with BOS showing a greater value (6.90) than FOS (6.12).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Supplementation of the diet with fish oil, which is rich in the long-chain n-3 polyunsaturated fatty acids eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), is reported to decrease several markers of immune function. However, whether EPA, DHA, or a combination of the 2 exerts these immunomodulatory effects is unclear. Objective: The objective of the study was to determine the effects of supplementation with an EPA-rich or DHA-rich oil on a range of immune outcomes representing key functions of human neutrophils, monocytes, and lymphocytes in healthy humans. Design: In a placebo-controlled, double-blind, parallel study, 42 healthy subjects were randomly allocated to receive supplementation with either placebo (olive oil), EPA (4.7 g/d), or DHA (4.9 g/d) for 4 wk. Blood samples were taken before and after supplementation. Results: The fatty acid composition of plasma phospholipids and neutrophils was dramatically altered by supplementation with EPA or DHA, and the effects of EPA differed notably from those of DHA. DHA supplementation decreased T lymphocyte activation, as assessed by expression of CD69, whereas EPA supplementation had no significant effect. Neither the EPA-rich oil nor the DHA-rich oil had any significant effect on monocyte or neutrophil phagocytosis or on cytokine production or adhesion molecule expression by peripheral blood mononuclear cells. Conclusions: Supplementation with DHA, but not with EPA, suppresses T lymphocyte activation, as assessed by expression of CD69. EPA alone does not, therefore, influence CD69 expression. No other marker of immune function assessed in this study was significantly affected by either EPA or - DHA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Although there is considerable interest in the postprandial events involved in the absorption of dietary fats and the subsequent metabolism of diet-derived triacylglycerol-rich lipoproteins, little is known about the effects of meal fatty acids on the composition of these particles. Objective: We examined the effect of meal fatty acids on the lipid and apolipoprotein contents of triacylglycerol-rich lipoproteins. Design: Ten normolipidemic men received in random order a mixed meal containing 50 L, of a mixture of palm oil and cocoa butter [rich in saturated fatty acids (SFAs)], safflower oil [n-6 polyunsaturated fatty acids (PUFAs)]. or olive oil [monounsaturated fatty acids (MUFAs)] on 3 occasions. Fasting and postprandial apolipoproteins B-48. B-100, E. C-II, and C-III and lipids (triacylglycerol and cholesterol) were measured in plasma fractions with Svedberg flotation rates (S-f) >400 S-f 60-400, and S-f 20 - 60. Results: Calculation of the composition of the triacylglycerol-rich lipoproteins (expressed per mole of apolipoprotein B) showed notable differences in the lipid and apolipoprotein contents of the SFA-enriched particles in the S-f > 400 and S-f 60-400 fractions. After the SFA meal, triacylglycerol-rich lipoproteins in these fractions showed significantly greater amounts of triacylglycerol and of apolipoproteins C-II (Sf 60-400 fraction only), C-III, and E than were found after the MUFA meal (P < 0.02) and more cholesterol, apolipoprotein C-III (Sf > 400 fraction only), and apolipoprotein E than after the PUFA meal (P < 0.02). Conclusions: Differences in the composition of S-f > 400 and S-f 60-400 triacylglycerol-rich lipoproteins formed after saturated compared with unsaturated fatty acid-rich meals may explain differences in the metabolic handling of dietary fats.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Meal fatty acids have been shown to modulate the size and composition of triacylglycerol (TAG)-rich lipoproteins influencing the magnitude and duration of the postprandial plasma TAG response. As a result there is considerable interest in the origin of these meal fatty-acid induced differences in particle composition. Caco-2 cells were incubated over 4 days with fatty acid mixtures resembling the composition of saturated (SFA), monounsaturated (MUFA) and polyunsaturated fatty acid (PUFA)-rich meals fed in a previous postprandial study to determine their impact on lipoprotein synthesis and secretion. The MUFA- and PUFA-rich mixtures supported greater intracellular TAG, but not cholesterol accumulation compared with the SFA-rich mixture (P < 0.001). The MUFA-rich mixture promoted significantly greater TAG and cholesterol secretion than the other mixtures and significantly more apolipoprotein B-100 secretion than the PUFA-rich mixture (P < 0.05). Electron microscopy revealed the SFA-rich mixture had led to unfavourable effects on cellular morphology, compared with the unsaturated fatty acid-rich mixtures. Our findings suggest the MUFA-rich mixture, may support the formation of a greater number of TAG-rich lipoproteins, which is consistent with indirect observations from our human study. Our electron micrographs are suggestive that some endocytotic uptake of MUFA-rich taurocholate micelles may promote greater lipoprotein synthesis and secretion in Caco-2 cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this Study, volatile oxidation compounds formed in a commercial conjugated linoleic acid (CLA)-rich oil were quantified and results compared to those found in safflower oil (rich in linoleic acid, LA). Intact oil samples and pure triacylglycerols obtained following elimination of tocopherols and minor compounds were oxidised at 60 degrees C, and volatile oxidation compounds were analysed by solid phase microextraction-gas chromatography with flame ionisation detector and mass spectrometer. Results showed that while, as expected, hexanal was the major volatile oxidation compound found in oil and triacylglycerols rich in LA, both hexanal and heptanal equally were the most abundant compounds in oil and triacylglycerols rich in CLA. Besides, samples rich in CLA also showed significantly high quantities of trans-2-octenal and trans-2-nonenal and the latter, along with heptanal, were absent in samples rich in LA. Results for CLA samples were not easy to interpret since major volatiles found are not expected from theoretically stable hydroperoxides formed in CLA and could in part derive from dioxetanes coming from 1,2-cycloadclitions of CIA with oxygen. Overall, results obtained support evidence that oxidation mechanisms of CLA may differ than those of LA. Also, it was concluded that heptanal determination could serve as a useful marker of oxidation progress in CLA-rich oils. (C) 2008 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recognition as a cue to judgment in a novel, multi-option domain (the Sunday Times Rich List) is explored. As in previous studies, participants were found to make use of name recognition as a cue to the presumed wealth of individuals. Names that were recognized were judged to be the richest name from amongst the set presented at above chance levels. This effect persisted across situations in which more than one name was recognized; recognition was used as an inclusion criterion for the sub-set of names to be considered the richest of the set presented. However, when the question was reversed, and a “poorest” judgment was required, use of recognition as an exclusion criterion was observed only when a single name was recognized. Reaction times when making these judgments also show a distinction between “richest” and “poorest” questions with recognition of none of the options taking the longest time to judge in the “richest” question condition and full recognition of all the names presented taking longest to judge in the “poorest” question condition. Implications for decision-making using simple heuristics are discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background & aims The consumption of long chain n − 3 polyunsaturated fatty acids (LC n − 3 PUFA) is known to be cardio-protective. Data on the influence of LC n − 3 PUFA on arterial stiffness in the postprandial state is limited. The aim of this study was to investigate the acute effects of a LC n − 3 PUFA-rich meal on measures of arterial stiffness. Methods Twenty-five healthy subjects (12 men, 13 women) received a control and a LC n − 3 PUFA-rich meal on two occasions in a random order. Arterial stiffness was measured at baseline, 30, 60, 90, 120, 180 and 240 min after meal consumption by pulse wave analysis and digital volume pulse to derive an augmentation index and a stiffness index respectively. Blood samples were taken for measurement of lipids, glucose and insulin. Results Consumption of the LC n − 3 PUFA-rich meal had an attenuating effect on augmentation index (P = 0.02) and stiffness index (P = 0.03) compared with the control meal. A significant treatment effect (P = 0.036) was seen for plasma non-esterified fatty acids concentrations. Conclusions These data indicate that acute LC n − 3 PUFA-rich meal consumption can improve postprandial arterial stiffness. This has important implications for the beneficial properties of LC n − 3 PUFA and cardiovascular risk reduction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study focuses on the restoration of chalk grasslands over a 6-year period and tests the efficacy of two management practices, hay spreading and soil disturbance, in promoting this process for phytophagous beetles. Restoration success for the beetles, measured as similarity to target species-rich chalk grassland, was not found to be influenced by either management practice. In contrast, restoration success for the plants did increase in response to hay spreading management. Although the presence of suitable host plants was considered to dictate the earliest point at which phytophagous beetles could successfully colonized, few beetle species colonized as soon as their host plants became established. Morphological characteristics and feeding habits of 27 phytophagous beetle species were therefore tested to identify factors that limited their colonization and persistence. The lag time between host plant establishment and colonization was greatest for flightless beetles. Beetles with foliage-feeding larvae both colonized at slower rates than seed-, stem-, or root-feeding species and persisted within the swards for shorter periods. Although the use of hay spreading may benefit plant communities during chalk grassland restoration, it did not directly benefit phytophagous beetles. Without techniques for overcoming colonization limitation for invertebrate taxa, short-term success of restoration may be limited to the plants only.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Electrospinning is a technique employed to produce nanoscale to microscale sized fibres by the application of a high voltage to a spinneret containing a polymer solution. Here we examine how small angle neutron scattering data can be modelled to analyse the polymer chain conformation. We prepared 1:1 blends of deuterated and hydrogenated atactic-polystyrene fibres from solutions in N, N-Dimethylformamide and Methyl Ethyl Ketone. The fibres themselves often contain pores or voiding within the internal structure on the length scales that can interfere with scattering experiments. A model to fit the scattering data in order to obtain values for the radius of gyration of the polymer molecules within the fibres has been developed, that includes in the scattering from the voids. Using this model we find that the radius of gyration is 20% larger than in the bulk state and the chains are slightly extended parallel to the fibre axis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Zn(CN)2 and Ni(CN)2 are known for exhibiting anomalous thermal expansion over a wide temperature range. The volume thermal expansion coefficient for the cubic, three dimensionally connected material, Zn(CN)2, is negative (alpha(V) = −51  10(-6) K-1) while for Ni(CN)2, a tetragonal material, the thermal expansion coefficient is negative in the two dimensionally connected sheets (alpha(a) = −7  10(-6) K-1), but the overall thermal expansion coefficient is positive (alpha(V) = 48  10(-6) K-1). We have measured the temperature dependence of phonon spectra in these compounds and analyzed them using ab initio calculations. The spectra of the two compounds show large differences that cannot be explained by simple mass renormalization of the modes involving Zn (65.38 amu) and Ni (58.69 amu) atoms. This reflects the fact that the structure and bonding are quite different in the two compounds. The calculated pressure dependence of the phonon modes and of the thermal expansion coefficient, alpha(V), are used to understand the anomalous behavior in these compounds. Our ab initio calculations indicate that phonon modes of energy approx. 2 meV are major contributors to negative thermal expansion (NTE) in both the compounds. The low-energy modes of approx.8 and 13 meV in Zn(CN)2 also contribute significantly to the NTE in Zn(CN)2 and Ni(CN)2, respectively. The measured temperature dependence of the phonon spectra has been used to estimate the total anharmonicity of both compounds. For Zn(CN)2, the temperature-dependent measurements (total anharmonicity), along with our previously reported pressure dependence of the phonon spectra (quasiharmonic), is used to separate the explicit temperature effect at constant volume (intrinsic anharmonicity).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present study was designed to examine whether the type of fat ingested in an initial test meal influences the response and density distribution of dietary-derived lipoproteins in the Svedberg flotation rate (Sf)>400, Sf 60 - 400 and Sf 20 - 60 lipoprotein fractions. A single-blind randomized within-subject crossover design was used to study the effects of palm oil, safflower oil, a mixture of fish and safflower oil, and olive oil on postprandial apolipoprotein (apo) B-48, retinyl ester and triacylglycerol responses in each lipoprotein fraction following an initial test meal containing one of the oils and a second standardized test meal. For all dietary oils, late postprandial (300min) concentrations of triacylglycerol and apo B-48 were significantly higher in the Sf 60 - 400 fraction than in the Sf>400 fraction (P<0.02). Significantly greater apo B-48 incremental areas under the curve (IAUCs) were also observed in the Sf 60 - 400 fraction than in the Sf>400 fraction following palm oil, safflower oil and olive oil (P<0.04), with a similar non-significant trend for fish/safflower oil. Olive oil resulted in a significantly greater apo B-48 IAUC in the Sf>400 fraction (P<0.02) than did any of the other dietary oils, as well as a tendency for a higher IAUC in the Sf 60 - 400 fraction compared with the palm, safflower and fish/safflower oils. In conclusion, we have found that the majority of intestinally derived lipoproteins present in the circulation following meals enriched with saturated, polyunsaturated or monounsaturated fatty acids are of the density and size of small chylomicrons and chylomicron remnants. Olive oil resulted in a greater apo B-48 response compared with the other dietary oils following sequential test meals, suggesting the formation of a greater number of small (Sf 60 - 400) and large (Sf>400) apo B-48-containing lipoproteins in response to this dietary oil.