77 resultados para Laser crystals
Resumo:
Surface properties of gluten proteins were measured in a dilation test and in compression and expansion tests. The results showed that monomeric gliadin was highly surface active, but polymer glutenin had almost no surface activity. The locations of those proteins in bread dough were investigated using confocal scanning laser microscopy and compared with polar and nonpolar lipids. Added gluten proteins participated in the formation of the film or the matrix, surrounding and separating individual gas cells in bread dough. Gliadin was found in the bulk of dough and gas 'cell walls'. Glutenin was found only in the bulk dough. Polar lipids were present in the protein matrix and in gas 'cell walls', as well as at the surface of some particles, which appeared to be starch granules. However, nonpolar lipid mainly occur-red on the surface of particles, which may be starch granules and small lipid droplets. It is suggested that the locations of gluten proteins in bread dough depends on their surface properties. Polar lipid participates the formation of gluten protein matrix and gas 'cell walls'. Nonpolar lipids may have an effect on the rheological properties by associating with starch granule surfaces and may form lipid droplets. (C) 2004 Published by Elsevier Ltd.
Resumo:
Changes in the theological properties during crystallisation and in the crystal size and morphology of blends containing rapeseed oil with varying percentages of palm stearin (POs) and palm olein (POf) have been studied. The crystals formed from all three blends were studied by confocal laser scanning microscopy, light microscopy and environmental scanning electron microscopy, which revealed the development of clusters of 3-5 individual elementary "spherulites" in the early stages of crystallisation. The saturated triacylglycerol content of the solid crystals separated at the onset of crystallisation was much greater than that in the total fat. Fat blends with a higher content of palm stearin had a more rapid nucleation rate when observed by light microscopy, and this caused an earlier change in the rheological properties of the fat during crystallisation. Using a low torque amplitude (0.005 Pa, which was within the linear viscoelastic region of all samples studied) and a frequency of 1 Hz, the viscoelastic properties of melted fat during cooling were studied. All samples, prior to crystallisation, showed weak viscoelastic liquid behaviour (G '', loss modulus >G', storage modulus). After crystallisation a more "solid like" behaviour was observed (G' similar to or greater than G ''). The blend having the highest concentration of POs was found to have the earliest onset of crystallisation (27% w/w POs; 12 mins, 22% w/w POs; 13.5 mins, 17% w/w POs, 15 mins, respectively). However, there were no significant differences in the time to the point when G' became greater than G' among the three blends. (c) 2006 Elsevier Ltd. All rights reserved.
Resumo:
The incorporation of caseins and whey proteins into acid gels produced from unheated and heat treated skimmed milk was studied by confocal scanning laser microscopy (CSLM) using fluorescent labelled proteins. Bovine casein micelles were labelled using Alexa Fluor 594, while whey proteins were labelled using Alexa Fluor 488. Samples of the labelled protein solutions were introduced into aliquots of pasteurised skim milk, and skim milk heated to 90 degrees C for 2 min and 95 degrees C for 8 min. The milk was acidified at 40 degrees C to a final pH of 4.4 using 20 g gluconodelta-lactone/l (GDL). The formation of gels was observed with CSLM at two wavelengths (488 nm and 594 nm), and also by visual and rheological methods. In the control milk, as pH decreased distinct casein aggregates appeared, and as further pH reduction occurred, the whey proteins could be seen to coat the casein aggregates. With the heated milks, the gel structure was formed of continuous strands consisting of both casein and whey protein. The formation of the gel network was correlated with an increase in the elastic modulus for all three treatments, in relation to the severity of heat treatment. This model system allows the separate observation of the caseins and whey proteins, and the study of the interactions between the two protein fractions during the formation of the acid gel structure, on a real-time basis. The system could therefore be a valuable tool in the study of structure formation in yoghurt and other dairy protein systems.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
Reactions in (molecular) organic crystalline solids have been shown to be important for exerting control that is unattainable over chemical transformations in solution. Such control has also been achieved for reactions within metal– organic cages. In these examples, the reactants are already in place within the crystals following the original crystal growth. The post-synthetic modification of metal–organic frameworks (MOFs and indeed reactions and catalysis within MOFs have been recently demonstrated; in these cases the reactants enter the crystals through permanent channels. Another growing area of interest within molecular solid-state chemistry is synthesis by mechanical co-grinding of solid reactants—often referred to as mechanochemistry. Finally, in a small number of reported examples, molecules also have been shown to enter nonporous crystals directly from the gas or vapor phase, but in only a few of these examples does a change in covalent bonding result, which indicates that a reaction occurs within the nonporous crystals. It is this latter type of highly uncommon reaction that is the focus of the present study.
Resumo:
The mechanisms of refractive index change in poly(methyl methacrylate) by frequency doubled femtosecond laser pulses are investigated. It is demonstrated that positive refractive index modificaton can be caused by a combination of depolymerization and crosslinking.
Resumo:
Laser beams emitted from the Geoscience Laser Altimeter System (GLAS), as well as other spaceborne laser instruments, can only penetrate clouds to a limit of a few optical depths. As a result, only optical depths of thinner clouds (< about 3 for GLAS) are retrieved from the reflected lidar signal. This paper presents a comprehensive study of possible retrievals of optical depth of thick clouds using solar background light and treating GLAS as a solar radiometer. To do so one must first calibrate the reflected solar radiation received by the photon-counting detectors of the GLAS 532-nm channel, the primary channel for atmospheric products. Solar background radiation is regarded as a noise to be subtracted in the retrieval process of the lidar products. However, once calibrated, it becomes a signal that can be used in studying the properties of optically thick clouds. In this paper, three calibration methods are presented: (i) calibration with coincident airborne and GLAS observations, (ii) calibration with coincident Geostationary Opera- tional Environmental Satellite (GOES) and GLAS observations of deep convective clouds, and (iii) cali- bration from first principles using optical depth of thin water clouds over ocean retrieved by GLAS active remote sensing. Results from the three methods agree well with each other. Cloud optical depth (COD) is retrieved from the calibrated solar background signal using a one-channel retrieval. Comparison with COD retrieved from GOES during GLAS overpasses shows that the average difference between the two retriev- als is 24%. As an example, the COD values retrieved from GLAS solar background are illustrated for a marine stratocumulus cloud field that is too thick to be penetrated by the GLAS laser. Based on this study, optical depths for thick clouds will be provided as a supplementary product to the existing operational GLAS cloud products in future GLAS data releases.
Resumo:
We present an application of cavity-enhanced absorption spectroscopy with an off-axis alignment of the cavity formed by two spherical mirrors and with time integration of the cavity-output intensity for detection of nitrogen dioxide (NO2) and iodine monoxide (IO) radicals using a violet laser diode at lambda = 404.278 nm. A noise-equivalent (1sigma = root-mean-square variation of the signal) fractional absorption for one optical pass of 4.5x10(-8) was demonstrated with a mirror reflectivity of similar to0.99925, a cavity length of 0.22 m and a lock-in-amplifier time constant of 3 s. Noise-equivalent detection sensitivities towards nitrogen dioxide of 1.8x10(10) molecule cm(-3) and towards the IO radical of 3.3x10(9) molecule cm(-3) were achieved in flow tubes with an inner diameter of 4 cm for a lock-in-amplifier time constant of 3 s. Alkyl peroxy radicals were detected using chemical titration with excess nitric oxide (RO2 + NO --> RO + NO2). Measurement of oxygen-atom concentrations was accomplished by determining the depletion of NO2 in the reaction NO2 + O --> NO + O-2. Noise-equivalent concentrations of alkyl peroxy radicals and oxygen atoms were 3x10(10) molecule cm(-3) in the discharge-flow-tube experiments.
Resumo:
Objectives: Our objective was to test the performance of CA125 in classifying serum samples from a cohort of malignant and benign ovarian cancers and age-matched healthy controls and to assess whether combining information from matrix-assisted laser desorption/ionization (MALDI) time-of-flight profiling could improve diagnostic performance. Materials and Methods: Serum samples from women with ovarian neoplasms and healthy volunteers were subjected to CA125 assay and MALDI time-of-flight mass spectrometry (MS) profiling. Models were built from training data sets using discriminatory MALDI MS peaks in combination with CA125 values and tested their ability to classify blinded test samples. These were compared with models using CA125 threshold levels from 193 patients with ovarian cancer, 290 with benign neoplasm, and 2236 postmenopausal healthy controls. Results: Using a CA125 cutoff of 30 U/mL, an overall sensitivity of 94.8% (96.6% specificity) was obtained when comparing malignancies versus healthy postmenopausal controls, whereas a cutoff of 65 U/mL provided a sensitivity of 83.9% (99.6% specificity). High classification accuracies were obtained for early-stage cancers (93.5% sensitivity). Reasons for high accuracies include recruitment bias, restriction to postmenopausal women, and inclusion of only primary invasive epithelial ovarian cancer cases. The combination of MS profiling information with CA125 did not significantly improve the specificity/accuracy compared with classifications on the basis of CA125 alone. Conclusions: We report unexpectedly good performance of serum CA125 using threshold classification in discriminating healthy controls and women with benign masses from those with invasive ovarian cancer. This highlights the dependence of diagnostic tests on the characteristics of the study population and the crucial need for authors to provide sufficient relevant details to allow comparison. Our study also shows that MS profiling information adds little to diagnostic accuracy. This finding is in contrast with other reports and shows the limitations of serum MS profiling for biomarker discovery and as a diagnostic tool
Resumo:
The physical and empirical relationships used by microphysics schemes to control the rate at which vapor is transferred to ice crystals growing in supercooled clouds are compared with laboratory data to evaluate the realism of various model formulations. Ice crystal growth rates predicted from capacitance theory are compared with measurements from three independent laboratory studies. When the growth is diffusion- limited, the predicted growth rates are consistent with the measured values to within about 20% in 14 of the experiments analyzed, over the temperature range −2.5° to −22°C. Only two experiments showed significant disagreement with theory (growth rate overestimated by about 30%–40% at −3.7° and −10.6°C). Growth predictions using various ventilation factor parameterizations were also calculated and compared with supercooled wind tunnel data. It was found that neither of the standard parameterizations used for ventilation adequately described both needle and dendrite growth; however, by choosing habit-specific ventilation factors from previous numerical work it was possible to match the experimental data in both regimes. The relationships between crystal mass, capacitance, and fall velocity were investigated based on the laboratory data. It was found that for a given crystal size the capacitance was significantly overestimated by two of the microphysics schemes considered here, yet for a given crystal mass the growth rate was underestimated by those same schemes because of unrealistic mass/size assumptions. The fall speed for a given capacitance (controlling the residence time of a crystal in the supercooled layer relative to its effectiveness as a vapor sink, and the relative importance of ventilation effects) was found to be overpredicted by all the schemes in which fallout is permitted, implying that the modeled crystals reside for too short a time within the cloud layer and that the parameterized ventilation effect is too strong.
Resumo:
Experiments were performed to investigate the evolution of structure and morphology of the network in polymer-stabilised liquid crystals. In situ optical microscopy revealed that the morphology was significantly altered by extraction of the LC host, while scanning electron microscopy showed that the network morphology was also dependent on the polymerisation conditions and closely related to the depletion of monomer, as monitored by high performance liquid chromatography. Transmission electron microscopy allowed observation of internal structure, resolving microstructure on the order of 0. 1 μm.