72 resultados para Grünwald-Letnikov derivative
Resumo:
Psoralens are well-known photosensitizers, and 8- methoxypsoralen and 4,5',8-trimethylpsoralen are widely used in photomedicine as "psoralens plus UVA therapy" (PUVA), in photopheresis, and in sterilization of blood preparations. In an attempt to improve the therapeutic efficiency of PUVA therapy and photopheresis, four poly(ethylene glycol) (PEG)-psoralen conjugates were synthesized to promote tumor targeting by the enhanced permeability and retention (EPR) effect. Peptide linkers were used to exploit specific enzymatic cleavage by lysosomal proteases. A new psoralen, 4-hydroxymethyl-4', 8-dimethylpsoralen (6), suitable for polymer conjugation was synthesized. The hydroxy group allowed exploring different strategies for PEG conjugation, and linkages with different stability such ester or urethanes were obtained. PEG (5 kDa) was covalently conjugated to the new psoralen derivative using four different linkages, namely, (i) direct ester bond (7), (ii) ester linkage with a peptide spacer (8), (iii) a carbamic linker (9), and (iv) a carbamic linker with a peptide spacer (12). The stability of these new conjugates was assessed at different pHs, in plasma and following incubation with cathepsin B. Conjugates 7 and 8 were rapidly hydrolyzed in plasma, while 9 was stable in buffer and in the presence of cathepsin B. As expected, only the conjugates containing the peptide linker released the drug in presence of cathepsin B. In vitro evaluation of the cytotoxic activity in the presence and absence of light was carried out in two cell lines (MCF-7 and A375 cells). Conjugates 7 and 8 displayed a similar activity to the free drug (probably due to the low stability of the ester linkage). Interestingly, the conjugates containing the carbamate linkage (9 and 12) were completely inactive in the dark (IC50 > 100 mu M in both cell lines). However, antiproliferative activity become apparent after UV irradiation. Conjugate 12 appears to be the most promising for future in vivo evaluation, since it was relatively stable in plasma, which should allow tumor targeting and drug release to occur by cathepsin B-mediated hydrolysis.
Resumo:
This paper presents a novel intelligent multiple-controller framework incorporating a fuzzy-logic-based switching and tuning supervisor along with a generalised learning model (GLM) for an autonomous cruise control application. The proposed methodology combines the benefits of a conventional proportional-integral-derivative (PID) controller, and a PID structure-based (simultaneous) zero and pole placement controller. The switching decision between the two nonlinear fixed structure controllers is made on the basis of the required performance measure using a fuzzy-logic-based supervisor, operating at the highest level of the system. The supervisor is also employed to adaptively tune the parameters of the multiple controllers in order to achieve the desired closed-loop system performance. The intelligent multiple-controller framework is applied to the autonomous cruise control problem in order to maintain a desired vehicle speed by controlling the throttle plate angle in an electronic throttle control (ETC) system. Sample simulation results using a validated nonlinear vehicle model are used to demonstrate the effectiveness of the multiple-controller with respect to adaptively tracking the desired vehicle speed changes and achieving the desired speed of response, whilst penalising excessive control action. Crown Copyright (C) 2008 Published by Elsevier B.V. All rights reserved.
Resumo:
Fractionation of a MeOH/CH2Cl2 (1/1) extract of the aerial parts of Senecio erechtitoides led to the isolation of six compounds including the hitherto unknown N-phenethylamide derivative named N-(p-hydroxyphenethyl)pentacosanamide (1), and a kauranoid derivative named derivative named ent-7-oxo-16 alpha,17-dihydroxykauran-19-oic acid (2), as well as four known compounds, ent-Kaur-16-en-19-oic acid (3), ent-7 beta-hydroxykaur-16-en-19-oic acid (4), ent-7-oxokaur-16-en-19-oic acid (5), steppogenin 4′-O-beta-d-glucoside (6). Their structures and relative configurations were elucidated on the basis of spectroscopic methods, chemical reactions, and comparison with previously known analogs. All isolates were evaluated for their antimicrobial activity and only diterpenoids were found to possess a potent inhibitor effect against the range of microorganism.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
IR, UV-vis, and EPR spectroelectrochemistry at variable temperatures and in different solvents were applied to investigate in situ the formation of electroactive molecular chains with a nonbridged Os-Os backbone, in particular, the polymer [Os-0(bpy)(CO)(2)](n), (bpy = 2,2'-bipyridine), from a mononuclear Os(II) carbonyl precursor, [Os-II(bpy)(CO)(2)Cl-2]. The one-electron-reduced form, [Os-II(bpy(.-))(CO)(2)Cl-2](-), has been characterized spectroscopically at low temperatures. This radical anion is the key intermediate in the electrochemical propagation process responsible for the metal-metal bond formation. Unambiguous spectroscopic evidence has been gained also for the formation of [{Os-0(bpy(.-))(CO)(2)}(-)](n), the electron-rich electrocatalyst of CO2 reduction. The polymer species are fairly well soluble in butyronitrile, which is important for their potential utilization in nanoscience, for example, as conducting molecular wires. We have also shown that complete solubility is accomplished for the monocarbonyl-acetonitrile derivative of the polymer, [Os-0(bpy)(CO)(MeCN)(2)Cl](n).
Resumo:
Electrochemical and photochemical properties of the tetrahedral cluster [Ru3Ir(mu(3)-H)(CO)(13)] were studied in order to prove whether the previously established thermal conversion of this cluster into the hydrogenated derivative [Ru3Ir(mu-H)(3)(CO)(12)] also occurs by means of redox or photochemical activation. Two-electron reduction of [Ru3Ir(mu(3)-H)(CO)(13)] results in the loss of CO and concomitant formation of the dianion [Ru3Ir(mu(3)-H)(CO)(12)](2-). The latter reduction product is stable in CH2Cl2 at low temperatures but becomes partly protonated above 283 K into the anion [Ru3Ir(mu-H)(2)(CO)(12)](-) by traces of water. The dianion [Ru3Ir(mu(3)-H)(CO)(12)](2-) is also the product of the electrochemical reduction of [Ru3Ir(mu-H)(3)(CO)(12)] accompanied by the loss of H-2. Stepwise deprotonation of [Ru3Ir(mu-H)(3)(CO)(12)] with Et4NOH yields [Ru3Ir(mu-H)(2)(CO)(12)](-) and [Ru3Ir(mu(3)-H)(CO)(12)](2-). Reverse protonation of the anionic clusters can be achieved, e. g., with trifluoromethylsulfonic acid. Thus, the electrochemical conversion of [Ru3Ir(mu(3)-H)(CO)(13)] into [Ru3Ir(mu-H)(3)(CO)(12)] is feasible, demanding separate two-electron reduction and protonation steps. Irradiation into the visible absorption band of [Ru3Ir(mu3-H)(CO)(13)] in hexane does not induce any significant photochemical conversion. Irradiation of this cluster in the presence of CO with lambda(irr) > 340 nm, however, triggers its efficient photofragmentation into reactive unsaturated ruthenium and iridium carbonyl fragments. These fragments are either stabilised by dissolved CO or undergo reclusterification to give homonuclear clusters. Most importantly, in H-2-saturated hexane, [Ru3Ir(mu(3)-H)(CO)(13)] converts selectively into the [Ru3Ir(mu-H)(3)(CO)(12)] photoproduct. This conversion is particularly efficient at lambda(irr) > 340 nm.
Resumo:
Rifaximin, a rifamycin derivative, has been reported to induce clinical remission of active Crohn's disease (CD), a chronic inflammatory bowel disorder. In order to understand how rifaximin affects the colonic microbiota and its metabolism, an in vitro human colonic model system was used in this study. We investigated the impact of the administration of 1800 mg/day of rifaximin on the faecal microbiota of four patients affected by colonic active CD [Crohn's disease activity index (CDAI > 200)] using a continuous culture colonic model system. We studied the effect of rifaximin on the human gut microbiota using fluorescence in situ hybridization, quantitative PCR and PCR–denaturing gradient gel electrophoresis. Furthermore, we investigated the effect of the antibiotic on microbial metabolic profiles, using 1H-NMR and solid phase microextraction coupled with gas chromatography/mass spectrometry, and its potential genotoxicity and cytotoxicity, using Comet and growth curve assays. Rifaximin did not affect the overall composition of the gut microbiota, whereas it caused an increase in concentration of Bifidobacterium, Atopobium and Faecalibacterium prausnitzii. A shift in microbial metabolism was observed, as shown by increases in short-chain fatty acids, propanol, decanol, nonanone and aromatic organic compounds, and decreases in ethanol, methanol and glutamate. No genotoxicity or cytotoxicity was attributed to rifaximin, and conversely rifaximin was shown to have a chemopreventive role by protecting against hydrogen peroxide-induced DNA damage. We demonstrated that rifaximin, while not altering the overall structure of the human colonic microbiota, increased bifidobacteria and led to variation of metabolic profiles associated with potential beneficial effects on the host.
Resumo:
Bis-valine derivatives or malonamide (Guha,S.; Drew, M.G.B. Small 2008, 4, 1993-2005) and a bis-valine derivative of 1,1-cyclopropone dicarboxamide were used as building blocks for the construction of supramolecular helical structures. The six-membered intramolecular hydrogen-bonded scaffold is formed, and this acts as a unique supramolecular synthon for the construction of a pseudopeptide-based supramolecular helical structure. However, in absence of this intramolecular hydrogen bond. intermolecular hydrogen bonds are formed among the peptide strands. This leads to a supramolecular beta-sheet structure. Proper selection of the supramolecular synthon (six-membered intramolecular hydrogenbonded scaffold) promotes supramolecular helix formation, and a deviation from this molecular structure dictates the disruption of supramolecular helicity. In this study, six crystal structures have been used to demonstrate that a change in the central angle and/or the central core structure of dicarboxamides can be used to design either a supramolecular helix or a beta-sheet.
Resumo:
A novel algorithm for solving nonlinear discrete time optimal control problems with model-reality differences is presented. The technique uses Dynamic Integrated System Optimisation and Parameter Estimation (DISOPE) which has been designed to achieve the correct optimal solution in spite of deficiencies in the mathematical model employed in the optimisation procedure. A method based on Broyden's ideas is used for approximating some derivative trajectories required. Ways for handling con straints on both manipulated and state variables are described. Further, a method for coping with batch-to- batch dynamic variations in the process, which are common in practice, is introduced. It is shown that the iterative procedure associated with the algorithm naturally suits applications to batch processes. The algorithm is success fully applied to a benchmark problem consisting of the input profile optimisation of a fed-batch fermentation process.
Resumo:
A novel optimising controller is designed that leads a slow process from a sub-optimal operational condition to the steady-state optimum in a continuous way based on dynamic information. Using standard results from optimisation theory and discrete optimal control, the solution of a steady-state optimisation problem is achieved by solving a receding-horizon optimal control problem which uses derivative and state information from the plant via a shadow model and a state-space identifier. The paper analyzes the steady-state optimality of the procedure, develops algorithms with and without control rate constraints and applies the procedure to a high fidelity simulation study of a distillation column optimisation.
Resumo:
Removal of silyl protection from D-glucose derived substrate 6 afforded 7, which upon acetonide deprotection followed by reaction with N-benzylhydroxylamine furnished two isomeric isoxazolidinocyclopentane derivatives via spontaneous cyclization of an in situ generated nitrone. The methyl xanthate derivative of the tertiary hydroxyl group of one isomer was isolated and subjected to radical deoxygenation reaction to form epimeric products, while with the other isomer it underwent spontaneous 1,2-elimination to form a mixture of the two possible endocyclic olefins. Hydrogenolytic cleavage of the isoxazolidine rings of the purified products followed by insertion of 5-amino-4-chloropyrimidine moiety and purine ring construction smoothly afforded structurally unique carbanucleoside analogues. Various spectroscopic methods on the synthesized compounds and X-ray analysis on one important intermediate were used to assign the structures and stereochemistry of the products.
Resumo:
Volatility, or the variability of the underlying asset, is one of the key fundamental components of property derivative pricing and in the application of real option models in development analysis. There has been relatively little work on volatility in real terms of its application to property derivatives and the real options analysis. Most research on volatility stems from investment performance (Nathakumaran & Newell (1995), Brown & Matysiak 2000, Booth & Matysiak 2001). Historic standard deviation is often used as a proxy for volatility and there has been a reliance on indices, which are subject to valuation smoothing effects. Transaction prices are considered to be more volatile than the traditional standard deviations of appraisal based indices. This could lead, arguably, to inefficiencies and mis-pricing, particularly if it is also accepted that changes evolve randomly over time and where future volatility and not an ex-post measure is the key (Sing 1998). If history does not repeat, or provides an unreliable measure, then estimating model based (implied) volatility is an alternative approach (Patel & Sing 2000). This paper is the first of two that employ alternative approaches to calculating and capturing volatility in UK real estate for the purposes of applying the measure to derivative pricing and real option models. It draws on a uniquely constructed IPD/Gerald Eve transactions database, containing over 21,000 properties over the period 1983-2005. In this first paper the magnitude of historic amplification associated with asset returns by sector and geographic spread is looked at. In the subsequent paper the focus will be upon model based (implied) volatility.
Resumo:
The Arctic has undergone substantial changes over the last few decades in various cryospheric and derivative systems and processes. Of these, the Arctic sea ice regime has seen some of the most rapid change and is one of the most visible markers of Arctic change outside the scientific community. This has drawn considerable attention not only from the natural sciences, but increasingly, from the political and commercial sectors as they begin to grapple with the problems and opportunities that are being presented. The possible impacts of past and projected changes in Arctic sea ice, especially as it relates to climatic response, are of particular interest and have been the subject of increasing research activity. A review of the current knowledge of the role of sea ice in the climate system is therefore timely. We present a review that examines both the current state of understanding, as regards the impacts of sea-ice loss observed to date, and climate model projections, to highlight hypothesised future changes and impacts on storm tracks and the North Atlantic Oscillation. Within the broad climate-system perspective, the topics of storminess and large-scale variability will be specifically considered. We then consider larger-scale impacts on the climatic system by reviewing studies that have focused on the interaction between sea-ice extent and the North Atlantic Oscillation. Finally, an overview of the representation of these topics in the literature in the context of IPCC climate projections is presented. While most agree on the direction of Arctic sea-ice change, the rates amongst the various projections vary greatly. Similarly, the response of storm tracks and climate variability are uncertain, exacerbated possibly by the influence of other factors. A variety of scientific papers on the relationship between sea-ice changes and atmospheric variability have brought to light important aspects of this complex topic. Examples are an overall reduction in the number of Arctic winter storms, a northward shift of mid-latitude winter storms in the Pacific and a delayed negative NAO-like response in autumn/winter to a reduced Arctic sea-ice cover (at least in some months). This review paper discusses this research and the disagreements, bringing about a fresh perspective on this issue.
Resumo:
A neural network was used to map three PID operating regions for a two-input two-output steam generator system. The network was used in stand alone feedforward operation to control the whole operating range of the process, after being trained from the PID controllers corresponding to each control region. The network inputs are the plant error signals, their integral, their derivative and a 4-error delay train.
Resumo:
This article examines the characteristics of key measures of volatility for different types of futures contracts to provide a better foundation for modeling volatility behavior and derivative values. Particular attention is focused on analyzing how different measures of volatility affect volatility persistence relationships. Intraday realized measures of volatility are found to be more persistent than daily measures, the type of GARCH procedure used for conditional volatility analysis is critical, and realized volatility persistence is not coherent with conditional volatility persistence. Specifically, although there is a good fit between the realized and conditional volatilities, no coherence exists between their degrees of persistence, a counterintuitive finding that shows realized and conditional volatility measures are not a substitute for one another