Hydroxyselanylation of acyloxycyclohex-3-enes

In contrast to the corresponding hydroxyiodination reactions, the reaction of acetoxycyclohex-2-ene 1 with N-PSP in the presence of water shows little regiocontrol, but is highly diastereoselective. However, the same reaction of the (R)-phenylglycinate derivative of (+/-)-cyclohexen-3-ol is highly diastereoselective, and regioselective. A hydrogen-bonding interaction is proposed to rationalize these differing selectivities. (c) 2007 Published by Elsevier Ltd.

Conformational and hydration effects of site-selective sodium, calcium and strontium ion binding to the DNA Holliday junction structure d(TCGGTACCGA)(4)

The role of metal ions in determining the solution conformation of the Holliday junction is well established, but to date the picture of metal ion binding from structural studies of the four-way DNA junction is very incomplete. Here we present two refined structures of the Holliday junction formed by the sequence d(TCGGTACCGA) in the presence of Na+ and Ca2+, and separately with Sr2+ to resolutions of 1.85 Angstrom and 1.65 Angstrom, respectively. This sequence includes the ACC core found to promote spontaneous junction formation, but its structure has not previously been reported. Almost complete hydration spheres can be defined for each metal cation. The Na+ sites, the most convincing observation of such sites in junctions to date, are one on either face of the junction crossover region, and stabilise the ordered hydration inside the junction arms. The four Ca2+ sites in the same structure are at the CG/CG steps in the minor groove. The Sr2+ ions occupy the TC/AG, GG/CC, and TA/TA sites in the minor groove, giving ten positions forming two spines of ions, spiralling through the minor grooves within each arm of the stacked-X structure. The two structures were solved in the two different C2 lattices previously observed, with the Sr2+ derivative crystallising in the more highly symmetrical form with two-fold symmetry at its centre. Both structures show an opening of the minor groove face of the junction of 8.4degrees in the Ca2+ and Na+ containing structure, and 13.4degrees in the Sr2+ containing structure. The crossover angles at the junction are 39.3degrees and 43.3degrees, respectively. In addition to this, a relative shift in the base pair stack alignment of the arms of 2.3 Angstrom is observed for the Sr2+ containing structure only. Overall these results provide an insight into the so-far elusive stabilising ion structure for the DNA Holliday junction. (C) 2003 Elsevier Science Ltd. All rights reserved.

Solvothermal synthesis of novel antimony sulphides containing [Sb4S7](2-) units

Two new antimony sulphides have been prepared solvothermally and characterised by single-crystal X-ray diffraction. [Co(en)(3)][Sb4S7] (1) was prepared at 140 degreesC from COS, Sb2S3 and S in the presence of ethylenediamine, whilst heating a mixture of Sb2S3, Co and S in tris(2aminoethyl)amine, N(CH2CH2NH2)(3), at 180 degreesC fegults in the formation of [C6H20N4][Sb4S7] (2). Both materials contain [Sb4S7](2-) chains formed from linkage of cyclic Sb3S63- units by SbS33- pyramids. In (1), the [Sb4S7] chains are linked by secondary Sb-S interactions to form sheets, between which the. charge balancing [Co(en)(3)](2+) cations reside. The structure of (2) involves interconnection of pairs of [Sb4S7](2-) chains through Sb2S2 rings to form isolated [Sb4S7](2-) double chains which are interleaved by protonated template molecules. (C) 2004 Elsevier B.V. All rights resereved.

Effects of calcium-chelating agents and pasteurisation on certain properties of calcium-fortified soy milk

Addition of 25 mM calcium chloride to soy milk reduced pH, increased ionic calcium and caused it to coagulate. The effects of different chelating agents were investigated on selected physicochemical properties of soy milk and on preventing coagulation. The soy milks were then pasteurised to examine how heat treatment changed some of these properties as well as to evaluate their effects on heat stability. Sediment formation and susceptibility to coagulation could be reduced by decreasing ionic calcium and increasing pH. To achieve this, the most effective chelating agents were tri-sodium citrate and disodium hydrogen phosphate. These chelating agents also reduce absolute viscosity and particle size. Sodium hexa meta phosphate was also effective, but less so; it reduced ionic calcium but had a less noticeable effect on pH. The disodium salt of ethylenediamine tetraacetic acid was not effective, as it decreased the pH of soy milk. Ionic calcium and pH are useful indicators of heat stability of calcium-fortified soy beverages. (C) 2009 Elsevier Ltd. All rights reserved.

The reaction of flavanols with nitrous acid protects against N-nitrosamine formation and leads to the formation of nitroso derivatives which inhibit cancer cell growth

Studies have suggested that diets rich in polyphenols Such as flavonoids may lead to a reduced risk of gastrointestinal cancers. We demonstrate the ability of monomeric and dimeric flavanols to scavenge reactive nitrogen species derived from nitrous acid. Both epicatechin and dimer B2 (epicatechin dimer) inhibited nitrous acid-induced formation of 3-nitrotyrosine and the formation of the carcinogenic N-nitrosamine, N-nitrosodimethylamine. The reaction of monomeric and dimeric epicatechin with nitrous acid led to the formation of mono- and di-nitroso flavanols, whereas the reaction with hesperetin resulted primarily in the formation of nitrated products. Although, epicatechin was transferred across the jejunum of the small intestine yielding metabolites, its nitroso form was not absorbed. Dimer B2 but not epicatechin monomer inhibited the proliferation of, and triggered apoptosis in, Caco-2 cells. The latter was accompanied by caspase-3 activation and reductions in Akt phosphorylation, suggesting activation of apoptosis via inhibition of prosurvival signaling. Furthermore, the dinitroso derivative of dimer B2, and to a lesser extent the dinitroso-epicatechin, also induced significant toxic effects in Caco-2 cells. The inhibitory effects on cellular proliferation were paralleled by early inhibition of ERK 1/2 phosphorylation and later reductions in cyclin D I levels, indicating modulation of cell cycle regulation in Caco-2 cells. These effects highlight multiple routes in which dietary derived flavanols may exert beneficial effects in the gastrointestinal tract. (c) 2005 Elsevier Inc. All rights reserved.

The fate of olive oil polyphenols in the gastrointestinal tract: implications of gastric and colonic microflora-dependent biotransformation

We have conducted a detailed investigation into the absorption, metabolism and microflora-dependent transformation of hydroxytyrosol ( HT), tyrosol (TYR) and their conjugated forms, such as oleuropein (OL). Conjugated forms underwent rapid hydrolysis under gastric conditions, resulting in significant increases in the amount of free HT and TYR entering the small intestine. Both HT and TYR transferred across human Caco-2 cell monolayers and rat segments of jejunum and ileum and were subject to classic phase I/II biotransformation. The major metabolites identified were an O-methylated derivative of HT, glucuronides of HT and TYR and a novel glutathionylated conjugate of HT. In contrast, there was no absorption of OL in either model. However, OL was rapidly degraded by the colonic microflora resulting in the formation of HT. Our study provides additional information regarding the breakdown of complex olive oil polyphenols in the GI tract, in particular the stomach and the large intestine.

A homo-proline tetrazole as an improved organocatalyst for the asymmetric Michael addition of carbonyl compounds to nitro-olefins

A new homo-proline tetrazole derivative 7 has been prepared and shown to have improved properties for achieving asymmetric Michael addition of carbonyl compounds to nitro-olefins.

Synthesis and biological in vitro evaluation of novel PEG-psoralen conjugates

Psoralens are well-known photosensitizers, and 8- methoxypsoralen and 4,5',8-trimethylpsoralen are widely used in photomedicine as "psoralens plus UVA therapy" (PUVA), in photopheresis, and in sterilization of blood preparations. In an attempt to improve the therapeutic efficiency of PUVA therapy and photopheresis, four poly(ethylene glycol) (PEG)-psoralen conjugates were synthesized to promote tumor targeting by the enhanced permeability and retention (EPR) effect. Peptide linkers were used to exploit specific enzymatic cleavage by lysosomal proteases. A new psoralen, 4-hydroxymethyl-4', 8-dimethylpsoralen (6), suitable for polymer conjugation was synthesized. The hydroxy group allowed exploring different strategies for PEG conjugation, and linkages with different stability such ester or urethanes were obtained. PEG (5 kDa) was covalently conjugated to the new psoralen derivative using four different linkages, namely, (i) direct ester bond (7), (ii) ester linkage with a peptide spacer (8), (iii) a carbamic linker (9), and (iv) a carbamic linker with a peptide spacer (12). The stability of these new conjugates was assessed at different pHs, in plasma and following incubation with cathepsin B. Conjugates 7 and 8 were rapidly hydrolyzed in plasma, while 9 was stable in buffer and in the presence of cathepsin B. As expected, only the conjugates containing the peptide linker released the drug in presence of cathepsin B. In vitro evaluation of the cytotoxic activity in the presence and absence of light was carried out in two cell lines (MCF-7 and A375 cells). Conjugates 7 and 8 displayed a similar activity to the free drug (probably due to the low stability of the ester linkage). Interestingly, the conjugates containing the carbamate linkage (9 and 12) were completely inactive in the dark (IC50 > 100 mu M in both cell lines). However, antiproliferative activity become apparent after UV irradiation. Conjugate 12 appears to be the most promising for future in vivo evaluation, since it was relatively stable in plasma, which should allow tumor targeting and drug release to occur by cathepsin B-mediated hydrolysis.

Autonomous intelligent cruise control using a novel multiple-controller framework incorporating fuzzy-logic-based switching and tuning

This paper presents a novel intelligent multiple-controller framework incorporating a fuzzy-logic-based switching and tuning supervisor along with a generalised learning model (GLM) for an autonomous cruise control application. The proposed methodology combines the benefits of a conventional proportional-integral-derivative (PID) controller, and a PID structure-based (simultaneous) zero and pole placement controller. The switching decision between the two nonlinear fixed structure controllers is made on the basis of the required performance measure using a fuzzy-logic-based supervisor, operating at the highest level of the system. The supervisor is also employed to adaptively tune the parameters of the multiple controllers in order to achieve the desired closed-loop system performance. The intelligent multiple-controller framework is applied to the autonomous cruise control problem in order to maintain a desired vehicle speed by controlling the throttle plate angle in an electronic throttle control (ETC) system. Sample simulation results using a validated nonlinear vehicle model are used to demonstrate the effectiveness of the multiple-controller with respect to adaptively tracking the desired vehicle speed changes and achieving the desired speed of response, whilst penalising excessive control action. Crown Copyright (C) 2008 Published by Elsevier B.V. All rights reserved.

New alkamide and ent-kaurane diterpenoid derivatives from Senecio erechtitoides (Asteraceae)

Fractionation of a MeOH/CH2Cl2 (1/1) extract of the aerial parts of Senecio erechtitoides led to the isolation of six compounds including the hitherto unknown N-phenethylamide derivative named N-(p-hydroxyphenethyl)pentacosanamide (1), and a kauranoid derivative named derivative named ent-7-oxo-16 alpha,17-dihydroxykauran-19-oic acid (2), as well as four known compounds, ent-Kaur-16-en-19-oic acid (3), ent-7 beta-hydroxykaur-16-en-19-oic acid (4), ent-7-oxokaur-16-en-19-oic acid (5), steppogenin 4′-O-beta-d-glucoside (6). Their structures and relative configurations were elucidated on the basis of spectroscopic methods, chemical reactions, and comparison with previously known analogs. All isolates were evaluated for their antimicrobial activity and only diterpenoids were found to possess a potent inhibitor effect against the range of microorganism.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.