138 resultados para CLASSICAL-SOLUTIONS


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper tackles the problem of computing smooth, optimal trajectories on the Euclidean group of motions SE(3). The problem is formulated as an optimal control problem where the cost function to be minimized is equal to the integral of the classical curvature squared. This problem is analogous to the elastic problem from differential geometry and thus the resulting rigid body motions will trace elastic curves. An application of the Maximum Principle to this optimal control problem shifts the emphasis to the language of symplectic geometry and to the associated Hamiltonian formalism. This results in a system of first order differential equations that yield coordinate free necessary conditions for optimality for these curves. From these necessary conditions we identify an integrable case and these particular set of curves are solved analytically. These analytic solutions provide interpolating curves between an initial given position and orientation and a desired position and orientation that would be useful in motion planning for systems such as robotic manipulators and autonomous-oriented vehicles.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A finite-difference scheme based on flux difference splitting is presented for the solution of the two-dimensional shallow-water equations of ideal fluid flow. A linearised problem, analogous to that of Riemann for gasdynamics, is defined and a scheme, based on numerical characteristic decomposition, is presented for obtaining approximate solutions to the linearised problem. The method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second-order scheme which avoids non-physical, spurious oscillations. An extension to the two-dimensional equations with source terms, is included. The scheme is applied to a dam-break problem with cylindrical symmetry.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A one-dimensional shock (bore) reflection problem is discussed for the two-dimensional shallow water equations with cylindrical symmetry. The differential equations for a similarity solution are derived and solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Solutions of a two-dimensional dam break problem are presented for two tailwater/reservoir height ratios. The numerical scheme used is an extension of one previously given by the author [J. Hyd. Res. 26(3), 293–306 (1988)], and is based on numerical characteristic decomposition. Thus approximate solutions are obtained via linearised problems, and the method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second order scheme which avoids non-physical, spurious oscillations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A one-dimensional shock-reflection test problem in the case of slab, cylindrical or spherical symmetry is discussed for multi-component flows. The differential equations for a similarity solution are derived and then solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A new surface-crossing algorithm suitable for describing bond-breaking and bond-forming processes in molecular dynamics simulations is presented. The method is formulated for two intersecting potential energy manifolds which dissociate to different adiabatic states. During simulations, crossings are detected by monitoring an energy criterion. If fulfilled, the two manifolds are mixed over a finite number of time steps, after which the system is propagated on the second adiabat and the crossing is carried out with probability one. The algorithm is extensively tested (almost 0.5 mu s of total simulation time) for the rebinding of NO to myoglobin. The unbound surface ((FeNO)-N-...) is represented using a standard force field, whereas the bound surface (Fe-NO) is described by an ab initio potential energy surface. The rebinding is found to be nonexponential in time, in agreement with experimental studies, and can be described using two time constants. Depending on the asymptotic energy separation between the manifolds, the short rebinding timescale is between 1 and 9 ps, whereas the longer timescale is about an order of magnitude larger. NO molecules which do not rebind within 1 ns are typically found in the Xenon-4 pocket, indicating the high affinity of NO to this region in the protein.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We study weak solutions for a class of free-boundary problems which includes as a special case the classical problem of travelling gravity waves on water of finite depth. We show that such problems are equivalent to problems in fixed domains and study the regularity of their solutions. We also prove that in very general situations the free boundary is necessarily the graph of a function.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper represents the last technical contribution of Professor Patrick Parks before his untimely death in February 1995. The remaining authors of the paper, which was subsequently completed, wish to dedicate the article to Patrick. A frequency criterion for the stability of solutions of linear difference equations with periodic coefficients is established. The stability criterion is based on a consideration of the behaviour of a frequency hodograph with respect to the origin of coordinates in the complex plane. The formulation of this criterion does not depend on the order of the difference equation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In the present paper, we studied the preparation of biomimetic triblock copolymer (ABA) membranes in aqueous solution and their deposition into solid supports. The self-assembly structures of the ABA in aqueous solution was investigated by using optical microscopy, dynamic light scattering, electron microscopy (EM) and SAXS. Spherical and tubular polymersomes were found at the highest concentrations investigated. The mechanism of deposition on solid supports (mica and glass) was elucidated by using atomic force microscopy (AFM). The deposition results in the formation of a uniform defect-free membrane at suitable polymer concentrations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We describe a fluid cell for the measurement of aqueous solutions of biomolecules adapted particularly for the requirements of THz time-domain spectroscopy. The design is simple, requires small-volume samples, avoids cross-contamination and is inexpensive.