88 resultados para solutions
Resumo:
A finite-difference scheme based on flux difference splitting is presented for the solution of the two-dimensional shallow-water equations of ideal fluid flow. A linearised problem, analogous to that of Riemann for gasdynamics, is defined and a scheme, based on numerical characteristic decomposition, is presented for obtaining approximate solutions to the linearised problem. The method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second-order scheme which avoids non-physical, spurious oscillations. An extension to the two-dimensional equations with source terms, is included. The scheme is applied to a dam-break problem with cylindrical symmetry.
Resumo:
A one-dimensional shock (bore) reflection problem is discussed for the two-dimensional shallow water equations with cylindrical symmetry. The differential equations for a similarity solution are derived and solved numerically in conjunction with the Rankine-Hugoniot shock relations.
Resumo:
Solutions of a two-dimensional dam break problem are presented for two tailwater/reservoir height ratios. The numerical scheme used is an extension of one previously given by the author [J. Hyd. Res. 26(3), 293–306 (1988)], and is based on numerical characteristic decomposition. Thus approximate solutions are obtained via linearised problems, and the method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second order scheme which avoids non-physical, spurious oscillations.
Resumo:
A one-dimensional shock-reflection test problem in the case of slab, cylindrical or spherical symmetry is discussed for multi-component flows. The differential equations for a similarity solution are derived and then solved numerically in conjunction with the Rankine-Hugoniot shock relations.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.
Resumo:
This paper represents the last technical contribution of Professor Patrick Parks before his untimely death in February 1995. The remaining authors of the paper, which was subsequently completed, wish to dedicate the article to Patrick. A frequency criterion for the stability of solutions of linear difference equations with periodic coefficients is established. The stability criterion is based on a consideration of the behaviour of a frequency hodograph with respect to the origin of coordinates in the complex plane. The formulation of this criterion does not depend on the order of the difference equation.
Resumo:
In the present paper, we studied the preparation of biomimetic triblock copolymer (ABA) membranes in aqueous solution and their deposition into solid supports. The self-assembly structures of the ABA in aqueous solution was investigated by using optical microscopy, dynamic light scattering, electron microscopy (EM) and SAXS. Spherical and tubular polymersomes were found at the highest concentrations investigated. The mechanism of deposition on solid supports (mica and glass) was elucidated by using atomic force microscopy (AFM). The deposition results in the formation of a uniform defect-free membrane at suitable polymer concentrations.
Resumo:
We describe a fluid cell for the measurement of aqueous solutions of biomolecules adapted particularly for the requirements of THz time-domain spectroscopy. The design is simple, requires small-volume samples, avoids cross-contamination and is inexpensive.
Resumo:
In recent years, there has been an increase in research on conventions motivated by the game-theoretic contributions of the philosopher David Lewis. Prior to this surge in interest, discussions of convention in economics had been tied to the analysis of John Maynard Keynes's writings. These literatures are distinct and have very little overlap. Yet this confluence of interests raises interesting methodological questions. Does the use of a common term, convention, denote a set of shared concerns? Can we identify what differentiates the game theoretic models from the Keynesian ones? This paper maps out the three most developed accounts of convention within economics and discusses their relations with each other in an attempt to provide an answer.
Resumo:
MD simulation studies showing the influence of porosity and carbon surface oxidation on phenol adsorption from aqueous solutions on carbons are reported. Based on a realistic model of activated carbon, three carbon structures with gradually changed microporosity were created. Next, a different number of surface oxygen groups was introduced. The pores with diameters around 0.6 nm are optimal for phenol adsorption and after the introduction of surface oxygen functionalities, adsorption of phenol decreases (in accordance with experimental data) for all studied models. This decrease is caused by a pore blocking effect due to the saturation of surface oxygen groups by highly hydrogen-bounded water molecules.
Resumo:
We report the results of first systematic studies of organic adsorption from aqueous solutions onto relatively long single walled carbon nanotubes (four tubes, in initial and oxidised forms). Using molecular dynamics simulations (GROMACS package) we discuss the behaviour of tube-water as well as tube-adsorbate systems, for three different adsorbates (benzene, phenol and paracetamol).