103 resultados para lectron back-scattered diffraction


Relevância:

20.00% 20.00%

Publicador:

Resumo:

In the past two decades, the geometric pathways involved in the transformations between inverse bicontinuous cubic phases in amphiphilic systems have been extensively theoretically modeled. However, little experimental data exists on the cubic-cubic transformation in pure lipid systems. We have used pressure-jump time-resolved X-ray diffraction to investigate the transition between the gyroid Q(II)(G) and double-diamond Q(II)(D) phases in mixtures of 1-monoolein in 30 wt% water. We find for this system that the cubic-cubic transition occurs without any detectable intermediate structures. In addition, we have determined the kinetics of the transition, in both the forward and reverse directions, as a function of pressure-jump amplitude, temperature, and water content. A recently developed model allows (at least in principle) the calculation of the activation energy for lipid phase transitions from such data. The analysis is applicable only if kinetic reproducibility is achieved, at least within one sample, and achievement of such kinetic reproducibility is shown here, by carrying out prolonged pressure-cycling. The rate of transformation shows clear and consistent trends with pressure-jump amplitude, temperature, and water content, all of which are shown to be in agreement with the effect of the shift in the position of the cubic-cubic phase boundary following a change in the thermodynamic parameters.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Single crystal X-ray diffraction study reveals that the water soluble tetrapeptide H2N-Ile-Aib-Leu-m-ABA-CO2H, containing non-coded Aib (alpha-amino isobutyric acid) and m-ABA (meta-amino benzoic acid), crystallizes with two smallest possible diastereomeric beta-hairpin molecules in the asymmetric unit. Although in both of the molecules the chiralities at Ile(1) and Leu(3) are S, a conformational reversal in the back bone chain is observed to produce the beta-hairpins with beta-turn conformations of type II and II'. Interestingly Aib which is known to adopt helical conformation, adopts unusual semi-extended conformation with phi: -49.5(5)degrees, psi: 135.2(5)degrees in type II and phi: 50.6(6)degrees. psi: -137.0(4)degrees in type II' for occupying the i + 1 position of the beta-turns. The two hairpin molecules are further interlocked through intermolecular hydrogen bonds and electrostatic interactions between CO2- and -+NH3 groups to form dimeric supramolecular beta-hairpin aggregate in the crystal state. The CD measurement and 2D NMR study of the peptide in aqueous medium support the existence of beta-hairpin structure in water. (C) 2009 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The partitioning of minor trivalent actinides (An) from lanthanides (Ln) is one of the challenges in the chemical treatment of nuclear waste. The optimal ligand to carry out the separation of An(III) and Ln(III) using solvent extraction has to meet several important criteria: high selectivity towards the solute, chemical and radiolytic stability, stripping possibilities and recycling of the organic phase, high separation factors and good distribution ratio, to name just a few of them. A chronological line can be drawn along the development of each extraction ligand family and some milestones are emphasized in this overview. Further developments in organic synthesis of extracting ligands are expected.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The structure of gold cyanide, AuCN, has been determined at 10 and 300 K using total neutron diffraction. The structure consists of infinite -Au-(CN)-Au-(CN)-Au-(CN)- linear chains, hexagonally packed, with the gold atoms in sheets. The Au-C and Au-N bond lengths are found to be identical, with d(Au-C/N) = 1.9703(5) Angstrom at 300 K. This work supersedes a previous study, by others, which used Rietveld analysis of neutron Bragg diffraction in isolation, and found these bonds to have significantly different lengths (Deltad = 0.24 Angstrom) at 300 K. The total correlation function, T(r), at 10 and 300 K, has been modeled using information derived from total diffraction. The broadening of inter- and intrachain correlations differs markedly due to random displacements of the chains in the direction of the chain axes. This is a consequence of the relatively weak bonding between the chains. An explanation for the negative thermal expansion in the c-direction, which occurs between 10 and 300 K, is presented.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A model for the structure of amorphous molybdenum trisulfide, a-MoS3, has been created using reverse Monte Carlo methods. This model, which consists of chains Of MoS6 units sharing three sulfurs with each of its two neighbors and forming alternate long, nonbonded, and short, bonded, Mo-Mo separations, is a good fit to the neutron diffraction data and is chemically and physically realistic. The paper identifies the limitations of previous models based on Mo-3 triangular clusters in accounting for the available experimental data.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

X-ray reflectivity (XR) and grazing incidence X-ray diffraction (GIXD) have been used to examine an oxyethylene-b-oxybutylene (E23B8) copolymer film at the air-water interface. The XR data were fitted using both a one- and a two-layer model that outputted the film thickness, roughness, and electron density. The best fit to the experimental data was obtained using a two-layer model (representing the oxyethylene and oxybutylene blocks, respectively), which showed a rapid thickening of the copolymer film at pressures above 7 mN/m. The large roughness values found indicate a significant degree of intermixing between the blocks and back up the GIXD data, which showed no long range lateral ordering within the layer. It was found from the electron density model results that there is a large film densification at 7 mN/m, possibly suggesting conformational changes within the film, even though no such change occurs on the pressure-area isotherm at the same surface pressure.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Once unit-cell dimensions have been determined from a powder diffraction data set and therefore the crystal system is known (e.g. orthorhombic), the method presented by Markvardsen, David, Johnson & Shankland [Acta Cryst. (2001), A57, 47-54] can be used to generate a table ranking the extinction symbols of the given crystal system according to probability. Markvardsen et al. tested a computer program (ExtSym) implementing the method against Pawley refinement outputs generated using the TF12LS program [David, Ibberson & Matthewman (1992). Report RAL-92-032. Rutherford Appleton Laboratory, Chilton, Didcot, Oxon, UK]. Here, it is shown that ExtSym can be used successfully with many well known powder diffraction analysis packages, namely DASH [David, Shankland, van de Streek, Pidcock, Motherwell & Cole (2006). J. Appl. Cryst. 39, 910-915], FullProf [Rodriguez-Carvajal (1993). Physica B, 192, 55-69], GSAS [Larson & Von Dreele (1994). Report LAUR 86-748. Los Alamos National Laboratory, New Mexico, USA], PRODD [Wright (2004). Z. Kristallogr. 219, 1-11] and TOPAS [Coelho (2003). Bruker AXS GmbH, Karlsruhe, Germany]. In addition, a precise description of the optimal input for ExtSym is given to enable other software packages to interface with ExtSym and to allow the improvement/modification of existing interfacing scripts. ExtSym takes as input the powder data in the form of integrated intensities and error estimates for these intensities. The output returned by ExtSym is demonstrated to be strongly dependent on the accuracy of these error estimates and the reason for this is explained. ExtSym is tested against a wide range of data sets, confirming the algorithm to be very successful at ranking the published extinction symbol as the most likely. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Differential thermal expansion over the range 90-210 K has been applied successfully to determine the crystal structure of chlorothiazide from synchrotron powder diffraction data using direct methods. Key to the success of the approach is the use of a multi-data-set Pawley refinement to extract a set of reflection intensities that is more 'single-crystal-like' than those extracted from a single data set. The improvement in reflection intensity estimates is quantified by comparison with reference single-crystal intensities. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.