Crystal and molecular structure of the thioether-analogue of PEEK from X-ray powder data and diffraction-modelling

Analysis of X-ray powder data for the melt-crystallisable aromatic poly(thioether thioether ketone) [-S-Ar-S-Ar-CO-Ar](n), ('PTTK', Ar= 1,4-phenylene), reveals that it adopts a crystal structure very different from that established for its ether-analogue PEEK. Molecular modelling and diffraction-simulation studies of PTTK show that the structure of this polymer is analogous to that of melt-crystallised poly(thioetherketone) [-SAr-CO-Ar](n) in which the carbonyl linkages in symmetry-related chains are aligned anti-parallel to one another. and that these bridging units are crystallographically interchangeable. The final model for the crystal structure of PTTK is thus disordered, in the monoclinic space group 121a (two chains per unit cell), with cell dimensions a = 7.83, b = 6.06, c = 10.35 angstrom, beta = 93.47 degrees. (c) 2005 Elsevier Ltd. All rights reserved.

First structural analysis of a naphthalene-based poly(ether ketone): Crystal and molecular simulation from X-ray powder data and diffraction modeling

Polycondensation of 2,6-dihydroxynaphthalene with 4,4'-bis(4"-fluorobenzoyl)biphenyl affords a novel, semicrystalline poly(ether ketone) with a melting point of 406 degreesC and glass transition temperature (onset) of 168 degreesC. Molecular modeling and diffraction-simulation studies of this polymer, coupled with data from the single-crystal structure of an oligomer model, have enabled the crystal and molecular structure of the polymer to be determined from X-ray powder data. This structure-the first for any naphthalene-containing poly(ether ketone)-is fully ordered, in monoclinic space group P2(1)/b, with two chains per unit cell. Rietveld refinement against the experimental powder data gave a final agreement factor (R-wp) of 6.7%.

A pressure-jump time-resolved x-ray diffraction study of cubic-cubic transition kinetics in monoolein

In the past two decades, the geometric pathways involved in the transformations between inverse bicontinuous cubic phases in amphiphilic systems have been extensively theoretically modeled. However, little experimental data exists on the cubic-cubic transformation in pure lipid systems. We have used pressure-jump time-resolved X-ray diffraction to investigate the transition between the gyroid Q(II)(G) and double-diamond Q(II)(D) phases in mixtures of 1-monoolein in 30 wt% water. We find for this system that the cubic-cubic transition occurs without any detectable intermediate structures. In addition, we have determined the kinetics of the transition, in both the forward and reverse directions, as a function of pressure-jump amplitude, temperature, and water content. A recently developed model allows (at least in principle) the calculation of the activation energy for lipid phase transitions from such data. The analysis is applicable only if kinetic reproducibility is achieved, at least within one sample, and achievement of such kinetic reproducibility is shown here, by carrying out prolonged pressure-cycling. The rate of transformation shows clear and consistent trends with pressure-jump amplitude, temperature, and water content, all of which are shown to be in agreement with the effect of the shift in the position of the cubic-cubic phase boundary following a change in the thermodynamic parameters.

Structure of AuCN determined from total neutron diffraction

The structure of gold cyanide, AuCN, has been determined at 10 and 300 K using total neutron diffraction. The structure consists of infinite -Au-(CN)-Au-(CN)-Au-(CN)- linear chains, hexagonally packed, with the gold atoms in sheets. The Au-C and Au-N bond lengths are found to be identical, with d(Au-C/N) = 1.9703(5) Angstrom at 300 K. This work supersedes a previous study, by others, which used Rietveld analysis of neutron Bragg diffraction in isolation, and found these bonds to have significantly different lengths (Deltad = 0.24 Angstrom) at 300 K. The total correlation function, T(r), at 10 and 300 K, has been modeled using information derived from total diffraction. The broadening of inter- and intrachain correlations differs markedly due to random displacements of the chains in the direction of the chain axes. This is a consequence of the relatively weak bonding between the chains. An explanation for the negative thermal expansion in the c-direction, which occurs between 10 and 300 K, is presented.

Modeling the structure of amorphous MoS3: a neutron diffraction and reverse Monte Carlo study

A model for the structure of amorphous molybdenum trisulfide, a-MoS3, has been created using reverse Monte Carlo methods. This model, which consists of chains Of MoS6 units sharing three sulfurs with each of its two neighbors and forming alternate long, nonbonded, and short, bonded, Mo-Mo separations, is a good fit to the neutron diffraction data and is chemically and physically realistic. The paper identifies the limitations of previous models based on Mo-3 triangular clusters in accounting for the available experimental data.

The synthesis and characterisation of two new iron thioantimonates: [Fe(en)(3)](2)Sb2S5 center dot 0.55H(2)O and [Fe(en)(3)](2)Sb4S8

Two new iron thioantimonates, [Fe(en)(3)](2)Sb2S5 (.) 0.55H(2)O (1) and [Fe(en)(3)](2)Sb4S8 (2). were synthesised under solvothermal conditions from the reactions of Sb2S3, FeCl2 and S in the presence of ethylenediamine at 413 and 438 K, respectively. The products were characterised by single-crystal X-ray diffraction, elemental analysis and SQUID magnetometry. Compound 1 is unusual in containing isolated Sb2S54- anions formed from two corner-sharing SbS33- trigonal pyramids. These units are arranged in rippled layers, 4 A apart, parallel to the bc-plane. Octahedrally coordinated [Fe(en)(3)](2+) cations lie in depressions within these anionic layers. In compound (2), repeated corner linking of SbS33- trigonal pyramids generates SbS2- chains, which may be considered as a polymerised form of the Sb2S54- anions in 1. The SbS2- chains are separated by [Fe(en)(3)](2+) cations. In both compounds, there is an extensive network of hydrogen bonds between the nitrogen atoms of the ethylenediamine ligands and the sulfur atoms of the anions and, in the case of 1, the uncoordinated water molecule. (c) 2005 Elsevier Ltd. All rights reserved.

Solvothermal syntheses, crystal structures and properties of five new thloantimonates(III) containing the [Sb4S7](2-) anion

Five new thioantimonates have been synthesized in the presence of organic amines under solvothermal conditions and their structures determined by single-crystal X-ray diffraction. All of the compounds are layered and contain antimony-sulphide anions of stoichiometry [Sb4S7](2-), but the structure of the anion formed is dependent on the amine used in synthesis. (H3N(CH2)(4)NH3)[Sb4S7] (1) contains [Sb4S7](2-) double chains directed along [010]. Weak interchain Sb-S interactions between neighbouring chains cause the double chains to pack into layers in the ab plane. In the [001] direction, the layers of double chains alternate with doubly protonated diaminobutane molecules to which the chains are hydrogen bonded. Compounds of general formula (TH)(2)[Sb4S7] (T= CH3(CH2)(2)NH2 (2), (CH3)(2)CHNH2 (3), CH3(CH2)(3)NH2 (4) and CH3(CH2)(4)NH2 (5)) adopt a more complex structure in which [Sb3S8](7-) units are linked by Sb-3(3-) pyramids to form chains, which in turn are bridged by sulphur atoms to create sheets containing large heterorings. Pairs of such sheets form double layers of four atoms thickness that are stacked along [001]. Protonated amine molecules are located between anionic antimony-sulphide layers to which they are hydrogen bonded. Thermal analysis reveals that the decomposition temperature of materials containing [Sb4S7](2-) anions is dependent both on the structure of the anion, the lowest decomposition temperature being that of the low-dimensional phase (1) and on the identity of the amine, the decomposition temperature decreasing with an increasing number of carbon atoms and decreasing density. (c) 2005 Elsevier Inc. All rights reserved.

[Cr(C6H18N4)(SbS3)], a chromium complex containing an unusual bidentate SbS33- ligand

A new chromium-antimony-sulfide, [Cr(C6H18N4)(SbS3)], has been synthesised under solvothermal conditions from CrCl3. 6H(2)O, Sb2S3 and S in the presence of triethylenetetramine at 433 K and characterised by single-crystal X-ray diffraction, thermogravimetry, elemental analysis and SQUID magnetometry. The structure of [Cr(C6H18N4)(SbS3)] consists of neutral mononuclear chromium-centred complexes, in which the Cr3+ is chelated by one tetradentate triethylenetetramine molecule and a bidentate SbS33- ligand, yielding distorted octahedral coordination. Intermolecular hydrogen bonds link individual molecules into layers within the ac plane. Within a layer, molecules occur in pairs with each member related by a centre of inversion. The Cr...Cr separation within a pair is approximately 6.5 Angstrom. Magnetic susceptibility data reveal Curie-Weiss behaviour with mu(eff) = 3.819(3)/mu(B) and a negligible Weiss constant, indicative of non-interacting Cr3+ ions. (C) 2003 Elsevier Science Ltd. All rights reserved.

ExtSym: a program to aid space-group determination from powder diffraction data

Once unit-cell dimensions have been determined from a powder diffraction data set and therefore the crystal system is known (e.g. orthorhombic), the method presented by Markvardsen, David, Johnson & Shankland [Acta Cryst. (2001), A57, 47-54] can be used to generate a table ranking the extinction symbols of the given crystal system according to probability. Markvardsen et al. tested a computer program (ExtSym) implementing the method against Pawley refinement outputs generated using the TF12LS program [David, Ibberson & Matthewman (1992). Report RAL-92-032. Rutherford Appleton Laboratory, Chilton, Didcot, Oxon, UK]. Here, it is shown that ExtSym can be used successfully with many well known powder diffraction analysis packages, namely DASH [David, Shankland, van de Streek, Pidcock, Motherwell & Cole (2006). J. Appl. Cryst. 39, 910-915], FullProf [Rodriguez-Carvajal (1993). Physica B, 192, 55-69], GSAS [Larson & Von Dreele (1994). Report LAUR 86-748. Los Alamos National Laboratory, New Mexico, USA], PRODD [Wright (2004). Z. Kristallogr. 219, 1-11] and TOPAS [Coelho (2003). Bruker AXS GmbH, Karlsruhe, Germany]. In addition, a precise description of the optimal input for ExtSym is given to enable other software packages to interface with ExtSym and to allow the improvement/modification of existing interfacing scripts. ExtSym takes as input the powder data in the form of integrated intensities and error estimates for these intensities. The output returned by ExtSym is demonstrated to be strongly dependent on the accuracy of these error estimates and the reason for this is explained. ExtSym is tested against a wide range of data sets, confirming the algorithm to be very successful at ranking the published extinction symbol as the most likely. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved.

Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

A differential thermal expansion approach to crystal structure determination from powder diffraction data

Differential thermal expansion over the range 90-210 K has been applied successfully to determine the crystal structure of chlorothiazide from synchrotron powder diffraction data using direct methods. Key to the success of the approach is the use of a multi-data-set Pawley refinement to extract a set of reflection intensities that is more 'single-crystal-like' than those extracted from a single data set. The improvement in reflection intensity estimates is quantified by comparison with reference single-crystal intensities. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved

Structure determination from powder diffraction data

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

Disparity with respect to a local reference plane as a dominant cue for stereoscopic depth relief

Earlier studies showed that the disparity with respect to other visible points could not explain stereoacuity performance, nor could various spatial derivatives of disparity [Glennerster, A., McKee, S. P., & Birch, M. D. (2002). Evidence of surface-based processing of binocular disparity. Current Biology, 12:825-828; Petrov, Y., & Glennerster, A. (2004). The role of the local reference in stereoscopic detection of depth relief. Vision Research, 44:367-376.] Two possible cues remain: (i) local changes in disparity gradient or (ii) disparity with respect to an interpolated line drawn through the reference points. Here, we aimed to distinguish between these two cues. Subjects judged.. in a two AFC paradigm, whether a target dot was in front of a plane defined by three reference dots or, in other experiments, in front of a line defined by two reference dots. We tested different slants of the reference line or plane and different locations of the target relative to the reference points. For slanted reference lines or plane, stereoacuity changed little as the target position was varied. For judgments relative to a frontoparallel reference line, stereoacuity did vary with target position, but less than would be predicted by disparity gradient change. This provides evidence that disparity with respect to the reference plane is an important cue. We discuss the potential advantages of this measure in generating a representation of surface relief that is invariant to viewpoint transformations. (c) 2006 Elsevier Ltd. All rights reserved.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.