Chromium nanostructures formed by dewetting of heteroepitaxial films on W(100)

In this paper, we report the surprising formation of square-based facetted islands with linear dimension of the order of 500 nm upon dewetting of a Cr multilayer onW(100).We show that these square islands are composed of inclined facets surrounding a depressed center such that the facet slopes inward with the outer edges of the islands thicker than the centers. The islands’ shapes do not represent traditional equilibrium crystal shapes as expected for a Wulf construction. In situ UV and x-ray photoelectron emission microscopy allied to spatially resolved spectroscopy throws considerable light on the nature of the dewetting and shows that the metal surface between the islands remains covered by a thin pseudomorphic wetting layer of ∼1 ML. Low-energy electron diffraction and scanning tunneling and atomic force microscopies allow quantification of facet slopes, and we identify a predominance of tilted Cr(100) facets ±5◦ off of the substrate normal bound by (210) planes at ∼26◦. The epitaxial Cr islands adopt the bulk Cr lattice constant but are tilted with respect to the surface normal.We suggest that the Cr crystallite tilting creates a vicinal-like interface structure that determines the island morphology

Enzyme assisted extraction of chitin from shrimp shells (Litopenaeus vannamei)

BACKGROUND: Chemical chitin extraction generates large amounts of wastes and increases partial deacetylation of the product. Therefore, the use of biological methods for chitin extraction is an interesting alternative. The effects of process conditions on enzyme assisted extraction of chitin from the shrimp shells in a systematic way were the focal points of this study. RESULTS: Demineralisation conditions of 25C, 20 min, shells-lactic acid ratio of 1:1.1 w/w; and shells-acetic acid ratio of 1:1.2 w/w, the maximum demineralisation values were 98.64 and 97.57% for lactic and acetic acids, respectively. A total protein removal efficiency of 91.10% by protease from Streptomyces griseus with enzyme-substrate ratio 55 U/g, pH 7.0 and incubation time 3 h is obtained when the particle size range is 50-25 μm, which was identified as the most critical factor. The X-ray diffraction and 13C NMR spectroscopy analysis showed that the lower percent crystallinity and higher degree of acetylation of chitin from enzyme assisted extraction may exhibit better solubility properties and less depolymerisation in comparison with chitin from the chemical extraction. CONCLUSION: The present work investigates the effects of individual factors on process yields, and it has shown that, if the particle size is properly controlled a reaction time of 3 h is more than enough for deproteination by protease. Physicochemical analysis indicated that the enzyme assisted production of chitin seems appropriate to extract chitin, possibly retaining its native structure.

A Nyström method for a class of integral equations on the real line with applications to scattering by diffraction gratings and rough surfaces

We propose a Nystr¨om/product integration method for a class of second kind integral equations on the real line which arise in problems of two-dimensional scalar and elastic wave scattering by unbounded surfaces. Stability and convergence of the method is established with convergence rates dependent on the smoothness of components of the kernel. The method is applied to the problem of acoustic scattering by a sound soft one-dimensional surface which is the graph of a function f, and superalgebraic convergence is established in the case when f is infinitely smooth. Numerical results are presented illustrating this behavior for the case when f is periodic (the diffraction grating case). The Nystr¨om method for this problem is stable and convergent uniformly with respect to the period of the grating, in contrast to standard integral equation methods for diffraction gratings which fail at a countable set of grating periods.

On integral equation and least squares methods for scattering by diffraction gratings

In this paper we consider the scattering of a plane acoustic or electromagnetic wave by a one-dimensional, periodic rough surface. We restrict the discussion to the case when the boundary is sound soft in the acoustic case, perfectly reflecting with TE polarization in the EM case, so that the total field vanishes on the boundary. We propose a uniquely solvable first kind integral equation formulation of the problem, which amounts to a requirement that the normal derivative of the Green's representation formula for the total field vanish on a horizontal line below the scattering surface. We then discuss the numerical solution by Galerkin's method of this (ill-posed) integral equation. We point out that, with two particular choices of the trial and test spaces, we recover the so-called SC (spectral-coordinate) and SS (spectral-spectral) numerical schemes of DeSanto et al., Waves Random Media, 8, 315-414 1998. We next propose a new Galerkin scheme, a modification of the SS method that we term the SS* method, which is an instance of the well-known dual least squares Galerkin method. We show that the SS* method is always well-defined and is optimally convergent as the size of the approximation space increases. Moreover, we make a connection with the classical least squares method, in which the coefficients in the Rayleigh expansion of the solution are determined by enforcing the boundary condition in a least squares sense, pointing out that the linear system to be solved in the SS* method is identical to that in the least squares method. Using this connection we show that (reflecting the ill-posed nature of the integral equation solved) the condition number of the linear system in the SS* and least squares methods approaches infinity as the approximation space increases in size. We also provide theoretical error bounds on the condition number and on the errors induced in the numerical solution computed as a result of ill-conditioning. Numerical results confirm the convergence of the SS* method and illustrate the ill-conditioning that arises.

The molecular structure of hexamethyldigermane determined by gas-phase electron diffraction with theoretical calculations for (CH3)3M-M(CH3)3 Where M = C, Si, and Ge

Gas-phase electron diffraction (GED) data together with results from ab initio molecular orbital calculations (HF and MP2/6-311+G(d,p)) have been used to determine the structure of hexamethyldigermane ((CH3)3Ge-Ge(CH3)3). The equilibrium symmetry is D3d, but the molecule has a very low-frequency, largeamplitude, torsional mode (φCGeGeC) that lowers the thermal average symmetry. The effect of this largeamplitude mode on the interatomic distances was described by a dynamic model which consisted of a set of pseudoconformers spaced at even intervals. The amount of each pseudoconformer was obtained from the ab initio calculations (HF/6-311+G(d,p)). The results for the principal distances (ra) and angles (∠h1) obtained from the combined GED/ab initio (with estimated 1σ uncertainties) are r(Ge-Ge) ) 2.417(2) Å, r(Ge-C) ) 1.956(1) Å, r(C-H) ) 1.097(5) Å, ∠GeGeC ) 110.5(2)°, and ∠GeCH ) 108.8(6)°. Theoretical calculations were performed for the related molecules ((CH3)3Si-Si(CH3)3 and (CH3)3C-C(CH3)3).

Overproduction, purification and preliminary X-ray diffraction analysis of YncE, an iron-regulated Sec-dependent periplasmic protein from Escherichia coli

The yncE gene of Escherichia coli encodes a predicted periplasmic protein of unknown function. The gene is de-repressed under iron restriction through the action of the global iron regulator Fur. This suggests a role in iron acquisition, which is supported by the presence of the adjacent yncD gene encoding a potential TonB-dependent outer-membrane transporter. Here, the preliminary crystallographic structure of YncE is reported, revealing that it consists of a seven-bladed beta-propeller which resembles the corresponding domain of the `surface-layer protein' of Methanosarcina mazei. A full structure determination is under way in order to provide insight into the function of this protein.

Preliminary X-ray diffraction analysis of YcdB from Escherichia coli: a novel haem-containing and Tat-secreted periplasmic protein with a potential role in iron transport

YcdB is a periplasmic haem-containing protein from Escherichia coli that has a potential role in iron transport. It is currently the only reported haem-containing Tat-secreted substrate. Here, the overexpression, purification, crystallization and structure determination at 2.0 angstrom resolution are reported for the apo form of the protein. The apo-YcdB structure resembles those of members of the haem-dependent peroxidase family and thus confirms that YcdB is also a member of this family. Haem-soaking experiments with preformed apo-YcdB crystals have been optimized to successfully generate haem-containing YcdB crystals that diffract to 2.9 angstrom. Completion of model building and structure refinement are under way.

Crystal and molecular structure of the thioether-analogue of PEEK from X-ray powder data and diffraction-modelling

Analysis of X-ray powder data for the melt-crystallisable aromatic poly(thioether thioether ketone) [-S-Ar-S-Ar-CO-Ar](n), ('PTTK', Ar= 1,4-phenylene), reveals that it adopts a crystal structure very different from that established for its ether-analogue PEEK. Molecular modelling and diffraction-simulation studies of PTTK show that the structure of this polymer is analogous to that of melt-crystallised poly(thioetherketone) [-SAr-CO-Ar](n) in which the carbonyl linkages in symmetry-related chains are aligned anti-parallel to one another. and that these bridging units are crystallographically interchangeable. The final model for the crystal structure of PTTK is thus disordered, in the monoclinic space group 121a (two chains per unit cell), with cell dimensions a = 7.83, b = 6.06, c = 10.35 angstrom, beta = 93.47 degrees. (c) 2005 Elsevier Ltd. All rights reserved.

First structural analysis of a naphthalene-based poly(ether ketone): Crystal and molecular simulation from X-ray powder data and diffraction modeling

Polycondensation of 2,6-dihydroxynaphthalene with 4,4'-bis(4"-fluorobenzoyl)biphenyl affords a novel, semicrystalline poly(ether ketone) with a melting point of 406 degreesC and glass transition temperature (onset) of 168 degreesC. Molecular modeling and diffraction-simulation studies of this polymer, coupled with data from the single-crystal structure of an oligomer model, have enabled the crystal and molecular structure of the polymer to be determined from X-ray powder data. This structure-the first for any naphthalene-containing poly(ether ketone)-is fully ordered, in monoclinic space group P2(1)/b, with two chains per unit cell. Rietveld refinement against the experimental powder data gave a final agreement factor (R-wp) of 6.7%.

Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Jpowder: a Java-based program for the display and examination of powder diffraction data

The ability to display and inspect powder diffraction data quickly and efficiently is a central part of the data analysis process. Whilst many computer programs are capable of displaying powder data, their focus is typically on advanced operations such as structure solution or Rietveld refinement. This article describes a lightweight software package, Jpowder, whose focus is fast and convenient visualization and comparison of powder data sets in a variety of formats from computers with network access. Jpowder is written in Java and uses its associated Web Start technology to allow ‘single-click deployment’ from a web page, http://www.jpowder.org. Jpowder is open source, free and available for use by anyone.