Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Solvent influences on metastable polymorph lifetimes: real-time interconversions using energy dispersive X-ray diffractometry

Solvent influences on the crystallization of polymorph and hydrate forms of the nootropic drug piracetam (2-oxo-pyrrolidineacetamide) were investigated from water, methanol, 2-propanol, isobutanol, and nitromethane. Crystal growth profiles of piracetam polymorphs were constructed using time-resolved diffraction snapshots collected for each solvent system. Measurements were performed by in situ energy dispersive X-ray diffraction recorded in Station 16.4 at the synchrotron radiation source (SRS) at Daresbury Laboratory, CCLRC UK. Crystallizations from methanol, 2-propanol, isobutanol, and nitromethane progressed in a similar fashion with the initial formation of form I which then converted relatively quickly to form II with form III being generated upon further cooling. However, considerable differences were observed for the polymorphs lifetime and both the rate and temperature of conversion using the different solvents. The thermodynamically unstable form I was kinetically favored in isobutanol and nitromethane where traces of this polymorph were observed below 10 degrees C. In contrast, the transformation of form II and subsequent growth of form III were inhibited in 2-propanol and nitromethane solutions. Aqueous solutions produced hydrate forms of piracetam which are different from the reported monohydrate; this crystallization evolved through successive generation of transient structures which transformed upon exchange of intramolecular water between the liquid and crystalline phases. (c) 2007 Wiley-Liss, Inc. and the American Pharmacists Association J Pharm Sci 96:1069-1078, 2007.

Optimal 3D surface reconstruction from a small number of conventional 2D X-ray images

This paper describes a method for reconstructing 3D frontier points, contour generators and surfaces of anatomical objects or smooth surfaces from a small number, e. g. 10, of conventional 2D X-ray images. The X-ray images are taken at different viewing directions with full prior knowledge of the X-ray source and sensor configurations. Unlike previous works, we empirically demonstrate that if the viewing directions are uniformly distributed around the object's viewing sphere, then the reconstructed 3D points automatically cluster closely on a highly curved part of the surface and are widely spread on smooth or flat parts. The advantage of this property is that the reconstructed points along a surface or a contour generator are not under-sampled or under-represented because surfaces or contours should be sampled or represented with more densely points where their curvatures are high. The more complex the contour's shape, the greater is the number of points required, but the greater the number of points is automatically generated by the proposed method. Given that the number of viewing directions is fixed and the viewing directions are uniformly distributed, the number and distribution of the reconstructed points depend on the shape or the curvature of the surface regardless of the size of the surface or the size of the object. The technique may be used not only in medicine but also in industrial applications.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Small-angle x-ray scattering study of flow alignment of a thermotropic liquid crystal in the nematic and smectic phases

WThe capillary flow alignment of the thermotropic liquid crystal 4-n-octyl-4′-cyanobiphenyl in the nematic and smectic phases is investigated using time-resolved synchrotron small-angle x-ray scattering. Samples were cooled from the isotropic phase to erase prior orientation. Upon cooling through the nematic phase under Poiseuille flow in a circular capillary, a transition from the alignment of mesogens along the flow direction to the alignment of layers along the flow direction (mesogens perpendicular to flow) appears to occur continuously at the cooling rate applied. The transition is centered on a temperature at which the Leslie viscosity coefficient α3 changes sign. The configuration with layers aligned along the flow direction is also observed in the smectic phase. The transition in the nematic phase on cooling has previously been ascribed to an aligning-nonaligning or tumbling transition. At high flow rates there is evidence for tumbling around an average alignment of layers along the flow direction. At lower flow rates this orientation is more clearly defined. The layer alignment is ascribed to surface-induced ordering propagating into the bulk of the capillary, an observation supported by the parallel alignment of layers observed for a static sample at low temperatures in the nematic phase.

Synthesis, x-ray structure and anion binding properties of a cryptand-like hybrid calixpyrrole

The novel cryptand in/out-3, containing two tripyrrolemethane units briged by three 1,3- diisopropylidenbenzene arms was readily synthesized by a convergent three-step synthesis. It binds fluoride by inclusion with excellent selectivity with respect to a number of other tested anions. The structure of the free receptor and that of its fluoride complex were investigated in solution by NMR spectroscopy. The solid state X-ray structure of the free cryptand 3 was also determined.

Solving surface structures from normal incidence X-ray standing wave data

A program is provided to determine structural parameters of atoms in or adsorbed on surfaces by refinement of atomistic models towards experimentally determined data generated by the normal incidence X-ray standing wave (NIXSW) technique. The method employs a combination of Differential Evolution Genetic Algorithms and Steepest Descent Line Minimisations to provide a fast, reliable and user friendly tool for experimentalists to interpret complex multidimensional NIXSW data sets.

Syntheses, x-ray structures, photochemistry, redox properties, and DFT calculations of interconvertible fac- and mer-[Mn(SPS)(CO)3] isomers containing a flexible SPS-based pincer ligand

The lithium salt of the anionic SPS pincer ligand composed of a central hypervalent lambda(4)-phosphinine ring bearing two ortho-positioned diphenylphosphine sulfide side arms reacts with [Mn(CO)(5)Br] to give fac-[Mn(SPS)(CO)(3)], This isomer can be converted photochemicaily to mer-[Mn(SPS)(CO)(3)], with a very high quantum yield (0.80 +/- 0.05). The thermal backreaction is slow (taking ca. 8 h at room temperature), in contrast to rapid electrodecatalyzed mer-to-fac isomerization triggered by electrochemical reduction of mer-[Mn(SPS)(CO)(3)]. Both geometric isomers of [Mn(SPS)(CO)(3)] have been characterized by X-ray crystallography. Both isomers show luminescence from a low-lying (IL)-I-3 (SPS-based) excited state. The light emission of fac-[Mn(SPS)(CO)(3)] is largely quenched by the efficient photoisomerization occurring probably from a low-lying Mn-CO dissociative excited state. Density functional theory (DFT) and time-dependent DFT calculations describe the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) of fac- and mer-[Mn(CO)(3)(SPS)] as ligand-centered orbitals, largely localized on the phosphinine ring of the SPS pincer ligand. In line with the ligand nature of its frontier orbitals, fac-[Mn(SPS)(CO)(3)] is electrochemically reversibly oxidized and reduced to the corresponding radical cation and anion, respectively. The spectroscopic (electron paramagnetic resonance, IR, and UV-vis) characterization of the radical species provides other evidence for the localization of the redox steps on the SIPS ligand. The smaller HOMO-LUMO energy difference in the case of mer-[Mn(CO)(3)(SPS)], reflected in the electronic absorption and emission spectra, corresponds with its lower oxidation potential compared to that of the fac isomer. The thermodynamic instability of mer-[Mn(CO)(3)(SPS)], confirmed by the DFT calculations, increases upon one-electron reduction and oxidation of the complex.

Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

A potential lag between the open solar magnetic source flux and solar EUV and X-ray emissions as measured by the Earth's ionosphere during total solar eclipses

Measurements of the ionospheric E-region during total solar eclipses have been used to provide information about the evolution of the solar magnetic field and EUV and X-ray emissions from the solar corona and chromosphere. By measuring levels of ionisation during an eclipse and comparing these measurements with an estimate of the unperturbed ionisation levels (such as those made during a control day, where available) it is possible to estimate the percentage of ionising radiation being emitted by the solar corona and chromosphere. Previously unpublished data from the two eclipses presented here are particularly valuable as they provide information that supplements the data published to date. The eclipse of 23 October 1976 over Australia provides information in a data gap that would otherwise have spanned the years 1966 to 1991. The eclipse of 4 December 2002 over Southern Africa is important as it extends the published sequence of measurements. Comparing measurements from eclipses between 1932 and 2002 with the solar magnetic source flux reveals that changes in the solar EUV and X-ray flux lag the open source flux measurements by approximately 1.5 years. We suggest that this unexpected result comes about from changes to the relative size of the limb corona between eclipses, with the lag representing the time taken to populate the coronal field with plasma hot enough to emit the EUV and X-rays ionising our atmosphere.

Synthesis, X-ray crystal structures and properties of complex salts and sterically crowded heteroleptic complexes of group 10 metal ions with aromatic sulfonyl dithiocarbimates and triphenylphosphine ligand

Two new complex salts of the form (Bu4N)(2)[Ni(L)(2)] (1) and (Ph4P)(2)[Ni(L)(2)] (2) and four heteroleptic complexes cis-M(PPh3)(2)(L) [M = Ni(II) (3), Pd(II) (4), L = 4-CH3OC6H4SO2N=CS2] and cis-M(PPh3)(2)(L') [M = Pd(II) (5), Pt(II) (6), L' = C6H5SO2N=CS2] were prepared and characterized by elemental analyses, IR, H-1, C-13 and P-31 NMR and UV-Vis spectra, solution and solid phase conductivity measurements and X-ray crystallography. A minor product trans-Pd(PPh3)(2)(SH)(2), 4a was also obtained with the synthesis of 4. The NiS4 and MP2S2 core in the complex salts and heteroleptic complexes are in the distorted square-plane whereas in the trans complex, 4a the centrosymmetric PdS2P2 core is perforce square planar. X-ray crystallography revealed the proximity of the ortho phenyl proton of the PPh3 ligand to Pd(II) showing rare intramolecular C-H center dot center dot center dot Pd anagostic binding interactions in the palladium cis-5 and trans-4a complexes. The complex salts with sigma(rt) values similar to 10 (5) S cm (1) show semi-conductor behaviors. The palladium and platinum complexes show photoluminescence properties in solution at room temperature.

3D scanning by multiple fan beam X-ray sources and sensors

*** Purpose – Computer tomography (CT) for 3D reconstruction entails a huge number of coplanar fan-beam projections for each of a large number of 2D slice images, and excessive radiation intensities and dosages. For some applications its rate of throughput is also inadequate. A technique for overcoming these limitations is outlined. *** Design methodology/approach – A novel method to reconstruct 3D surface models of objects is presented, using, typically, ten, 2D projective images. These images are generated by relative motion between this set of objects and a set of ten fanbeam X-ray sources and sensors, with their viewing axes suitably distributed in 2D angular space. *** Findings – The method entails a radiation dosage several orders of magnitude lower than CT, and requires far less computational power. Experimental results are given to illustrate the capability of the technique *** Practical implications – The substantially lower cost of the method and, more particularly, its dramatically lower irradiation make it relevant to many applications precluded by current techniques *** Originality/value – The method can be used in many applications such as aircraft hold-luggage screening, 3D industrial modelling and measurement, and it should also have important applications to medical diagnosis and surgery.

Object-based three-dimensional X-ray imaging

A form of three-dimensional X-ray imaging, called Object 3-D, is introduced, where the relevant subject material is represented as discrete ‘objects’. The surface of each such object is derived accurately from the projections of its outline, and of its other discontinuities, in about ten conventional X-ray views, distributed in solid angle. This technique is suitable for many applications, and permits dramatic savings in radiation exposure and in data acquisition and manipulation. It is well matched to user-friendly interactive displays.