X‑ray crystal structure of rac-[Ru(phen)2dppz]2+ with d(ATGCAT)2 shows enantiomer orientations and water ordering

We report an atomic resolution X-ray crystal structure containing both enantiomers of rac-[Ru(phen)2dppz]2+ with the d-(ATGCAT)2 DNA duplex (phen = phenanthroline; dppz = dipyridophenazine). The first example of any enantiomeric pair crystallized with a DNA duplex shows different orientations of the Λ and Δ binding sites, separated by a clearly defined structured water monolayer. Job plots show that the same species is present in solution. Each enantiomer is bound at a TG/CA step and shows intercalation from the minor groove. One water molecule is directly located on one phenazine N atom in the Δ-enantiomer only.

Barley oxalate oxidase is a hexameric protein related to seed storage proteins: evidence from X-ray crystallography

The oxalate oxidase enzyme expressed in barley roots is a thermostable, protease-resistant enzyme that generates H2O2. It has great medical importance because of its use to assay plasma and urinary oxalate, and it has also been used to generate transgenic, pathogen-resistant crops. This protein has now been purified and three types of crystals grown. X-ray analysis shows that the symmetry present in these crystals is consistent with a hexameric arrangement of subunits, probably a trimer of dimers. This structure may be similar to that found in the related seed storage proteins.

Overproduction, purification and preliminary X-ray diffraction analysis of YncE, an iron-regulated Sec-dependent periplasmic protein from Escherichia coli

The yncE gene of Escherichia coli encodes a predicted periplasmic protein of unknown function. The gene is de-repressed under iron restriction through the action of the global iron regulator Fur. This suggests a role in iron acquisition, which is supported by the presence of the adjacent yncD gene encoding a potential TonB-dependent outer-membrane transporter. Here, the preliminary crystallographic structure of YncE is reported, revealing that it consists of a seven-bladed beta-propeller which resembles the corresponding domain of the `surface-layer protein' of Methanosarcina mazei. A full structure determination is under way in order to provide insight into the function of this protein.

Preliminary X-ray diffraction analysis of YcdB from Escherichia coli: a novel haem-containing and Tat-secreted periplasmic protein with a potential role in iron transport

YcdB is a periplasmic haem-containing protein from Escherichia coli that has a potential role in iron transport. It is currently the only reported haem-containing Tat-secreted substrate. Here, the overexpression, purification, crystallization and structure determination at 2.0 angstrom resolution are reported for the apo form of the protein. The apo-YcdB structure resembles those of members of the haem-dependent peroxidase family and thus confirms that YcdB is also a member of this family. Haem-soaking experiments with preformed apo-YcdB crystals have been optimized to successfully generate haem-containing YcdB crystals that diffract to 2.9 angstrom. Completion of model building and structure refinement are under way.

First structural analysis of a naphthalene-based poly(ether ketone): Crystal and molecular simulation from X-ray powder data and diffraction modeling

Polycondensation of 2,6-dihydroxynaphthalene with 4,4'-bis(4"-fluorobenzoyl)biphenyl affords a novel, semicrystalline poly(ether ketone) with a melting point of 406 degreesC and glass transition temperature (onset) of 168 degreesC. Molecular modeling and diffraction-simulation studies of this polymer, coupled with data from the single-crystal structure of an oligomer model, have enabled the crystal and molecular structure of the polymer to be determined from X-ray powder data. This structure-the first for any naphthalene-containing poly(ether ketone)-is fully ordered, in monoclinic space group P2(1)/b, with two chains per unit cell. Rietveld refinement against the experimental powder data gave a final agreement factor (R-wp) of 6.7%.

Crystallization in poly(L-lactide)-b-poly(epsilon-caprolactone) double crystalline diblock copolymers: a study using X-ray scattering, differential scanning calorimetry, and polarized optical microscopy

The crystallization of well-defined poly(L-lactide)-b-poly(epsilon-caprolactone) diblock copolymers, PLLA-b-PCL, was investigated by time-resolved X-ray techniques, polarized optical microscopy (POM), and differential scanning calorimetry (DSC). Two compositions were studied that contained 44 and 60 wt % poly(L-lactide), PLLA (they are referred to as (L44C5614)-C-11 and (L60C409)-C-12, respectively, with the molecular weight of each block in kg/mol as superscript). The copolymers were found to be initially miscible in the melt according to small-angle X-ray scattering measurements (SAXS). Their thermal behavior was also indicative of samples whose crystallization proceeds from a mixed melt. Sequential isothermal crystallization from the melt at 100 degreesC (for 30 min) and then at 30 degreesC (for 15 min) was measured. At 100 degreesC only the PLLA block is capable of crystallization, and its crystallization kinetics was followed by both WAXS and DSC; comparable results were obtained that indicated an instantaneous nucleation with three-dimensional superstructures (Avrami index of approximately 3). The spherulitic nature of the superstructure was confirmed by POM. When the temperature was decreased to 30 degreesC, the PCL block was able to crystallize within the PLLA negative spherulites (with an Avrami index of 2, as opposed to 3 in homo-PCL), and its crystallization rate was much slower than an equivalent homo-PCL. Time-resolved SAXS experiments in (L60C409)-C-12 revealed an initial melt mixed morphology at 165 degreesC that upon cooling transformed into a transient microphase-separated lamellar structure prior to crystallization at 100 degreesC.

X-ray crystallographic study of DNA duplex cross-linking: simultaneous binding to two d(CGTACG)(2) molecules by a bis(9-aminoacridine-4-carboxamide) derivative

Acridine-4-carboxamides form a class of known DNA mono-intercalating agents that exhibit cytotoxic activity against tumour cell lines due to their ability to inhibit topoisomerases. Previous studies of bis-acridine derivatives have yielded equivocal results regarding the minimum length of linker necessary between the two acridine chromophores to allow bis-intercalation of duplex DNA. We report here the 1.7 angstrom resolution X-ray crystal structure of a six-carbon-linked bis(acridine-4-carboxamide) ligand bound to d(CGTACG)(2) molecules by non-covalent duplex cross-linking. The asymmetric unit consists of one DNA duplex containing an intercalated acridine-4-carboxamide chromophore at each of the two CG steps. The other half of each ligand is bound to another DNA molecule in a symmetry-related manner, with the alkyl linker threading through the minor grooves. The two crystallographically independent ligand molecules adopt distinct side chain interactions, forming hydrogen bonds to either O6 or N7 on the major groove face of guanine, in contrast to the semi-disordered state of mono-intercalators bound to the same DNA molecule. The complex described here provides the first structural evidence for the non-covalent cross-linking of DNA by a small molecule ligand and suggests a possible explanation for the inconsistent behaviour of six-carbon linked bis-acridines in previous assays of DNA bis-intercalation.

Thallium pi-cation complexation by calix[4]tubes: Tl-205 NMR and X-ray evidence

Thallium cation complexation by calix[4]tubes has been investigated by a combination of (TI)-T-205, H-1 NMR and ES MS demonstrating the solution formation of a dithallium complex in which the cations are held in the calix[4]arene cavities. In addition, the structure of the complex has been determined in the solid state revealing the cations to be held exclusively by pi-cation interactions. Furthermore, this crystal structure has been used as the basis for molecular dynamics simulations to confirm that binding of the smaller K+ cation in the calix[4]tube cryptand like array occurs via the axial route featuring a g-cation intermediate.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

Phase separated structures in tethered dPS–PMMA copolymer films revealed using X-ray scattering with a novel contrast enhancement agent

Tethered deuterated polystyrene-block-polymethyl methacrylate films have been examined by X-ray scattering both in their native state and following treatment with ruthenium tetroxide. The use of the stain, while increasing the thickness of the films, does not significantly alter the lateral structure or periodicity of the films and provides contrast between the two blocks. Both the periodicity of the films and the structure normal to the surface have been identified following staining. Experiments were also performed on films treated by a solvent exchange process, and the effects of staining on these films are discussed.

Nickel(II) and copper(II) complexes of Schiff base ligands containing N4O2 and N4S2 donors with pyrrole terminal binding groups: synthesis, characterization, X-ray structures, DFT and electrochemical studies

A series of hexadentate ligands, H2Lm (m = 1−4), [1H-pyrrol-2-ylmethylene]{2-[2-(2-{[1H-pyrrol-2-ylmethylene]amino}phenoxy)ethoxy]phenyl}amine (H2L1), [1H-pyrrol-2-ylmethylene]{2-[4-(2-{[1H-pyrrol-2-ylmethylene]amino}phenoxy)butoxy]phenyl}amine (H2L2), [1H-pyrrol-2-ylmethylene][2-({2-[(2-{[1H-pyrrol-2-ylmethylene]amino}phenyl)thio]ethyl}thio)phenyl]amine (H2L3) and [1H-pyrrol-2-ylmethylene][2-({4-[(2-{[1H-pyrrol-2-lmethylene]amino}phenyl)thio]butyl}thio) phenyl]amine (H2L4) were prepared by condensation reaction of pyrrol-2-carboxaldehyde with {2-[2-(2-aminophenoxy)ethoxy]phenyl}amine, {2-[4-(2-aminophenoxy)butoxy]phenyl}amine, [2-({2-[(2-aminophenyl)thio]ethyl}thio)phenyl]amine and [2-({4-[(2-aminophenyl)thio]butyl}thio)phenyl]amine respectively. Reaction of these ligands with nickel(II) and copper(II) acetate gave complexes of the form MLm (m = 1−4), and the synthesized ligands and their complexes have been characterized by a variety of physico-chemical techniques. The solid and solution states investigations show that the complexes are neutral. The molecular structures of NiL3 and CuL2, which have been determined by single crystal X-ray diffraction, indicate that the NiL3 complex has a distorted octahedral coordination environment around the metal while the CuL2 complex has a seesaw coordination geometry. DFT calculations were used to analyse the electronic structure and simulation of the electronic absorption spectrum of the CuL2 complex using TDDFT gives results that are consistent with the measured spectroscopic behavior of the complex. Cyclic voltammetry indicates that all copper complexes are electrochemically inactive but the nickel complexes with softer thioethers are more easily oxidized than their oxygen analogs.

Wide-angle X-ray scattering study of structural parameters in non-crystalline polymers

The paper presents an analysis of WAXS (wide-angle X-ray scattering) data which aids an understanding of the structure of non-crystalline polymers. Experimental results are compared with calculations of scattering from possible models. Evidence is presented which supports the view that the chains in molten PE do not lie parallel but have a conformation in accord with the predictions of energy calculations. However, the evidence indicates that in “molten” PTFE the chains lie parallel over distances well in excess of their diameters. WAXS-based proposals are made for the conformations of a-PMMA and a-PS.

Wide-angle X-ray scattering for swollen and glassy poly(2-hydroxyethyl methacrylate)

The wide angle X-ray scattering from glassy poly(2-hydroxyethyl methacrylate) (1) is presented together with that obtained from oriented and swollen samples. The scattering is compared with that previously reported for poly(methyl methacrylate) (PMMA) and the structure discussed in relation to this polymer. The chain conformation is similar to that of PMMA, although some measure of molecular interlocking appears to reduce the main interchain peak while correlated regions of inaccessible free volume between the substantial side groups are held responsible for the main peak at s = 1,25 Å−1.

Synthesis and spectroscopic properties of cobalt(III) complexes of some aroyl hydrazones: x-ray crystal structures of one cobalt(III) complex and two aroyl hydrazone ligands

Cobalt(III) complexes of diacetyl monooxime benzoyl hydrazone (dmoBH(2)) and diacetyl monooxime isonicotinoyl hydrazone (dmoInH(2)) have been synthesized and characterized by elemental analyses and spectroscopic methods. The X-ray crystal structures of the two hydrazone ligands, as well as that of the cobalt(III) complex [Co(III)(dmoInH)(2)]Cl center dot 2H(2)O, are also reported. It is found that in the cobalt(III) complexes the Co(III) ion is hexa-coordinated, the hydrazone ligands behaving as mono-anionic tridentate O,N,N donors. In the [Co(III)(dmoInH) (2)]Cl center dot 2H(2)O complex, the amide and the oxime hydrogens are deprotonated for both the ligands, while the isonicotine nitrogens are protonated. In the [Co(III)(d-moBH)(2)] Cl complex, only the amide nitrogens are deprotonated. It is shown that the additional hydrogen bonding capability of the isonicotine nitrogen results in different conformation and supramolecular structure for dmoInH(2), compared to dmoBH(2), in the solid state. Comparing the structure of the [CoIII(dmoInH)(2)]Cl center dot 2H(2)O with that of the Zn(II) complex of the same ligand, reported earlier, it is seen that the metal ion has a profound influence on the supramolecular structure, due to change in geometrical dispositions of the chelate rings.