83 resultados para SHARP DIFFRACTION PEAK


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Combining geological knowledge with proved plus probable ('2P') oil discovery data indicates that over 60 countries are now past their resource-limited peak of conventional oil production. The data show that the global peak of conventional oil production is close. Many analysts who rely only on proved ('1P') oil reserves data draw a very different conclusion. But proved oil reserves contain no information about the true size of discoveries, being variously under-reported, over-reported and not reported. Reliance on 1P data has led to a number of misconceptions, including the notion that past oil forecasts were incorrect, that oil reserves grow very significantly due to technology gain, and that the global supply of oil is ensured provided sufficient investment is forthcoming to 'turn resources into reserves'. These misconceptions have been widely held, including within academia, governments, some oil companies, and organisations such as the IEA. In addition to conventional oil, the world contains large quantities of non-conventional oil. Most current detailed models show that past the conventional oil peak the non-conventional oils are unlikely to come on-stream fast enough to offset conventional's decline. To determine the extent of future oil supply constraints calculations are required to determine fundamental rate limits for the production of non-conventional oils, as well as oil from gas, coal and biomass, and of oil substitution. Such assessments will need to examine technological readiness and lead-times, as well as rate constraints on investment, pollution, and net-energy return. (C) 2007 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ability to display and inspect powder diffraction data quickly and efficiently is a central part of the data analysis process. Whilst many computer programs are capable of displaying powder data, their focus is typically on advanced operations such as structure solution or Rietveld refinement. This article describes a lightweight software package, Jpowder, whose focus is fast and convenient visualization and comparison of powder data sets in a variety of formats from computers with network access. Jpowder is written in Java and uses its associated Web Start technology to allow ‘single-click deployment’ from a web page, http://www.jpowder.org. Jpowder is open source, free and available for use by anyone.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The low-energy electron diffraction (LEED) pattern of the step-kinked Pt{531} surface at 200 K shows energy-dependent cancellation of diffraction spots over unusually large energy ranges, up to 100 eV. This cannot be reproduced theoretically when a flat surface geometry is assumed. A relatively simple model of roughening, however, involving 0.25 ML of vacancies and adatoms leads to very good agreement with the experiment. The cancellation of intensities within a very narrow range of adatom or vacancy coverages is caused by the interference of electrons emerging from different heights but similar local environments. This is a rare example where the energy dependence of integrated LEED spot intensities is dramatically affected by the long-range arrangement of atoms.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The adsorption of NO on Ir{100} has been studied as a function of NO coverage and temperature using temperature programmed reflection absorption infrared spectroscopy (TP-RAIRS), low energy electron diffraction (LEED) and temperature programmed desorption (TPD). After saturating the clean (1 x 5)-reconstructed surface with NO at 95 K. two N-2, desorption peaks are observed upon heating. The first N-2 peak at 346 K results from the decomposition of bridge-bonded NO, and the second at 475 K from the decomposition of atop-bonded NO molecules. NO decomposition is proposed to be the rate limiting step for both N-2 desorption states. For high NO coverages on the (1 x 5) surface, the narrow width of the first N-2 desorption peak is indicative of an autocatalytic process for which the parallel formation of N2O appears to be the crucial step. When NO is adsorbed on the metastable unreconstructed (1 x 1) phase of clean Ir{100} N-2 desorption starts at lower temperatures, indicating that this surface modification is more reactive. When a high coverage of oxygen, near 0.5 ML, is pre-adsorbed on the surface, the decomposition of NO is inhibited and mainly desorption of intact NO is observed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The adsorption of oxygen on the chiral Pt{531} surface was studied by high-resolution X-ray photoelectron spectroscopy (HRXPS) and low energy electron diffraction (LEED). After the surface is annealed in oxygen (3 x 10(-7) mbar), three O 1s peaks are observed in XPS. One peak, at 529.5 eV, is assigned to chemisorbed oxygen; it disappears after annealing in vacuo to temperatures above 900 K. The other two peaks at 530.8 and 532.3 eV are stable up to at least 1250 K. They are associated with oxide clusters on the surface. These clusters readily react with coadsorbed carbon monoxide at temperatures between 315 and 620 K.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We describe a FORTRAN-90 program that computes scattering t-matrices for a molecule. These can be used in a Low-Energy Electron Diffraction program to solve the molecular structural problem very efficiently. The intramolecular multiple scattering is computed within a Dyson-like approach, using free space Green propagators in a basis of spherical waves. The advantage of this approach is related to exploiting the chemical identity of the molecule, and to the simplicity to translate and rotate these t-matrices without performing a new multiple-scattering calculation for each configuration. FORTRAN-90 routines for rotating the resulting t-matrices using Wigner matrices are also provided.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We describe a FORTRAN-90 program to compute low-energy electron diffraction I(V) curves. Plane-waves and layer doubling are used to compute the inter-layer multiple-scattering, while the intra-layer multiple-scattering is computed in the standard way expanding the wavefield on a basis of spherical waves. The program is kept as general as possible, in order to allow testing different parts of multiple-scattering calculations. In particular, it can handle non-diagonal t-matrices describing the scattering of non-spherical potentials, anisotropic vibrations, anharmonicity, etc. The program does not use old FORTRAN flavours, and has been written keeping in mind the advantage for parallelism brought forward by FORTRAN-90.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent literature has described a “transition zone” between the average top of deep convection in the Tropics and the stratosphere. Here transport across this zone is investigated using an offline trajectory model. Particles were advected by the resolved winds from the European Centre for Medium-Range Weather Forecasts reanalyses. For each boreal winter clusters of particles were released in the upper troposphere over the four main regions of tropical deep convection (Indonesia, central Pacific, South America, and Africa). Most particles remain in the troposphere, descending on average for every cluster. The horizontal components of 5-day trajectories are strongly influenced by the El Niño–Southern Oscillation (ENSO), but the Lagrangian average descent does not have a clear ENSO signature. Tropopause crossing locations are first identified by recording events when trajectories from the same release regions cross the World Meteorological Organization lapse rate tropopause. Most crossing events occur 5–15 days after release, and 30-day trajectories are sufficiently long to estimate crossing number densities. In a further two experiments slight excursions across the lapse rate tropopause are differentiated from the drift deeper into the stratosphere by defining the “tropopause zone” as a layer bounded by the average potential temperature of the lapse rate tropopause and the profile temperature minimum. Transport upward across this zone is studied using forward trajectories released from the lower bound and back trajectories arriving at the upper bound. Histograms of particle potential temperature (θ) show marked differences between the transition zone, where there is a slow spread in θ values about a peak that shifts slowly upward, and the troposphere below 350 K. There forward trajectories experience slow radiative cooling interspersed with bursts of convective heating resulting in a well-mixed distribution. In contrast θ histograms for back trajectories arriving in the stratosphere have two distinct peaks just above 300 and 350 K, indicating the sharp change from rapid convective heating in the well-mixed troposphere to slow ascent in the transition zone. Although trajectories slowly cross the tropopause zone throughout the Tropics, all three experiments show that most trajectories reaching the stratosphere from the lower troposphere within 30 days do so over the west Pacific warm pool. This preferred location moves about 30°–50° farther east in an El Niño year (1982/83) and about 30° farther west in a La Niña year (1988/89). These results could have important implications for upper-troposphere–lower-stratosphere pollution and chemistry studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Peak picking is an early key step in MS data analysis. We compare three commonly used approaches to peak picking and discuss their merits by means of statistical analysis. Methods investigated encompass signal-to-noise ratio, continuous wavelet transform, and a correlation-based approach using a Gaussian template. Functionality of the three methods is illustrated and discussed in a practical context using a mass spectral data set created with MALDI-TOF technology. Sensitivity and specificity are investigated using a manually defined reference set of peaks. As an additional criterion, the robustness of the three methods is assessed by a perturbation analysis and illustrated using ROC curves.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Delayed peak response of plasma retinyl esters (RE) relative to plasma triacylglycerols (TAG) and apolipoprotein (Apo) B-48 responses following a fat load supplemented with vitamin A raised doubts about the use of vitamin A to label dietary-derived lipids and lipoproteins. The present study compared the use of water-miscible and oil-soluble retinyl palmitate (RP) as markers of dietary-derived lipoproteins in healthy subjects along with the measurements of postprandial plasma TAG and ApoB-48 responses to investigate whether the delayed peak response observed was due to delayed intestinal output of RE from oil-based solutions. Nine healthy female subjects were given a standard test meal containing a dose (112 mg) of RP in either water-miscible or oil-soluble form in random order, on two separate occasions after a 12 h overnight fast. The results showed that the mean plasma RE concentrations reached a peak significantly later than mean plasma TAG and ApoB-48 concentrations when oil-soluble RP was consumed, whereas plasma RE peaked earlier relative to plasma TAG and ApoB-48 responses when water-miscible RP was used. The results suggested a more rapid absorption with a significantly higher and earlier peak response of plasma RE when water-miscible RP was consumed. This was in contrast to the delayed initial appearance and later sustained higher concentrations of plasma RE during the late postprandial period when oil-soluble RP was consumed. The RE response to the water-miscible RP showed better concordance with plasma TAG response than that of oil-soluble RP.