66 resultados para Neutron probe


Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have used high energy transfer (HET) inelastic neutron scattering spectroscopy to measure the vibrational modes in the spectra of hydroxyapatite, bone and brushite to confirm our earlier work that only a fraction of the hydroxyl groups in bone mineral are substituted. The HET spectra are better observed due to the higher scattering cross section of hydrogen compared with the other elements in the calcium phosphate compounds. (C) 2003 Elsevier Science B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

High spatial resolution vertical profiles of pore-water chemistry have been obtained for a peatland using diffusive equilibrium in thin films (DET) gel probes. Comparison of DET pore-water data with more traditional depth-specific sampling shows good agreement and the DET profiling method is less invasive and less likely to induce mixing of pore-waters. Chloride mass balances as water tables fell in the early summer indicate that evaporative concentration dominates and there is negligible lateral flow in the peat. Lack of lateral flow allows element budgets for the same site at different times to be compared. The high spatial resolution of sampling also enables gradients to be observed that permit calculations of vertical fluxes. Sulfate concentrations fall at two sites with net rates of 1.5 and 5.0nmol cm− 3 day− 1, likely due to a dominance of bacterial sulfate reduction, while a third site showed a net gain in sulfate due to oxidation of sulfur over the study period at an average rate of 3.4nmol cm− 3 day− 1. Behaviour of iron is closely coupled to that of sulfur; there is net removal of iron at the two sites where sulfate reduction dominates and addition of iron where oxidation dominates. The profiles demonstrate that, in addition to strong vertical redox related chemical changes, there is significant spatial heterogeneity. Whilst overall there is evidence for net reduction of sulfate within the peatland pore-waters, this can be reversed, at least temporarily, during periods of drought when sulfide oxidation with resulting acid production predominates.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This report describes the aqueous solution self-assembly of a series of polystyrene(m)-b-poly(L-lysine)n block copolymers (m = 8-10; n = 10-70). The polymers are prepared by ring-opening polymerization of epsilon-benzyloxycarbonyl-L-lysine N-carboxyanhydride using amine terminated polystyrene macroinitiators, followed by removal of the benzyloxycarbonyl side chain protecting groups. The critical micelle concentration of the block copolymers determined using the pyrene probe technique shows a parabolic dependence on peptide block length exhibiting a maximum at n = approximately 20 (m = 8) or n = approximately 60 (m = 10). The shape and size of the aggregates has been studied by dynamic and static light scattering, small-angle neutron scattering (SANS), and analytical ultracentrifugation (AUC). Surprisingly, Holtzer and Kratky analysis of the static light scattering results indicates the presence of nonspherical, presumably cylindrical objects independent of the poly(L-lysine)n block length. This is supported by SANS data, which can be fitted well by assuming cylindrical scattering objects. AUC analysis allows the molecular weight of the aggregates to be estimated as several million g/mol, corresponding to aggregation numbers of several 10s to 100s. These aggregation numbers agree with those that can be estimated from the length and diameter of the cylinders obtained from the scattering results.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We present extensive molecular dynamics simulations of the dynamics of diluted long probe chains entangled with a matrix of shorter chains. The chain lengths of both components are above the entanglement strand length, and the ratio of their lengths is varied over a wide range to cover the crossover from the chain reptation regime to tube Rouse motion regime of the long probe chains. Reducing the matrix chain length results in a faster decay of the dynamic structure factor of the probe chains, in good agreement with recent neutron spin echo experiments. The diffusion of the long chains, measured by the mean square displacements of the monomers and the centers of mass of the chains, demonstrates a systematic speed-up relative to the pure reptation behavior expected for monodisperse melts of sufficiently long polymers. On the other hand, the diffusion of the matrix chains is only weakly perturbed by the diluted long probe chains. The simulation results are qualitatively consistent with the theoretical predictions based on constraint release Rouse model, but a detailed comparison reveals the existence of a broad distribution of the disentanglement rates, which is partly confirmed by an analysis of the packing and diffusion of the matrix chains in the tube region of the probe chains. A coarse-grained simulation model based on the tube Rouse motion model with incorporation of the probability distribution of the tube segment jump rates is developed and shows results qualitatively consistent with the fine scale molecular dynamics simulations. However, we observe a breakdown in the tube Rouse model when the short chain length is decreased to around N-S = 80, which is roughly 3.5 times the entanglement spacing N-e(P) = 23. The location of this transition may be sensitive to the chain bending potential used in our simulations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Electrospinning is a technique employed to produce nanoscale to microscale sized fibres by the application of a high voltage to a spinneret containing a polymer solution. Here we examine how small angle neutron scattering data can be modelled to analyse the polymer chain conformation. We prepared 1:1 blends of deuterated and hydrogenated atactic-polystyrene fibres from solutions in N, N-Dimethylformamide and Methyl Ethyl Ketone. The fibres themselves often contain pores or voiding within the internal structure on the length scales that can interfere with scattering experiments. A model to fit the scattering data in order to obtain values for the radius of gyration of the polymer molecules within the fibres has been developed, that includes in the scattering from the voids. Using this model we find that the radius of gyration is 20% larger than in the bulk state and the chains are slightly extended parallel to the fibre axis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Zn(CN)2 and Ni(CN)2 are known for exhibiting anomalous thermal expansion over a wide temperature range. The volume thermal expansion coefficient for the cubic, three dimensionally connected material, Zn(CN)2, is negative (alpha(V) = −51  10(-6) K-1) while for Ni(CN)2, a tetragonal material, the thermal expansion coefficient is negative in the two dimensionally connected sheets (alpha(a) = −7  10(-6) K-1), but the overall thermal expansion coefficient is positive (alpha(V) = 48  10(-6) K-1). We have measured the temperature dependence of phonon spectra in these compounds and analyzed them using ab initio calculations. The spectra of the two compounds show large differences that cannot be explained by simple mass renormalization of the modes involving Zn (65.38 amu) and Ni (58.69 amu) atoms. This reflects the fact that the structure and bonding are quite different in the two compounds. The calculated pressure dependence of the phonon modes and of the thermal expansion coefficient, alpha(V), are used to understand the anomalous behavior in these compounds. Our ab initio calculations indicate that phonon modes of energy approx. 2 meV are major contributors to negative thermal expansion (NTE) in both the compounds. The low-energy modes of approx.8 and 13 meV in Zn(CN)2 also contribute significantly to the NTE in Zn(CN)2 and Ni(CN)2, respectively. The measured temperature dependence of the phonon spectra has been used to estimate the total anharmonicity of both compounds. For Zn(CN)2, the temperature-dependent measurements (total anharmonicity), along with our previously reported pressure dependence of the phonon spectra (quasiharmonic), is used to separate the explicit temperature effect at constant volume (intrinsic anharmonicity).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Current force feedback, haptic interface devices are generally limited to the display of low frequency, high amplitude spatial data. A typical device consists of a low impedance framework of one or more degrees-of-freedom (dof), allowing a user to explore a pre-defined workspace via an end effector such as a handle, thimble, probe or stylus. The movement of the device is then constrained using high gain positional feedback, thus reducing the apparent dof of the device and conveying the illusion of hard contact to the user. Such devices are, however, limited to a narrow bandwidth of frequencies, typically below 30Hz, and are not well suited to the display of surface properties, such as object texture. This paper details a device to augment an existing force feedback haptic display with a vibrotactile display, thus providing a means of conveying low amplitude, high frequency spatial information of object surface properties. 1. Haptics and Haptic Interfaces Haptics is the study of human touch and interaction with the external environment via touch. Information from the human sense of touch can be classified in to two categories, cutaneous and kinesthetic. Cutaneous information is provided via the mechanoreceptive nerve endings in the glabrous skin of the human hand. It is primarily a means of relaying information regarding small-scale details in the form of skin stretch, compression and vibration.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We explicitly tested for the first time the ‘environmental specificity’ of traditional 16S rRNAtargeted fluorescence in situ hybridization (FISH) through comparison of the bacterial diversity actually targeted in the environment with the diversity that should be exactly targeted (i.e. without mismatches) according to in silico analysis. To do this, we exploited advances in modern Flow Cytometry that enabled improved detection and therefore sorting of sub-micron-sized particles and used probe PSE1284 (designed to target Pseudomonads) applied to Lolium perenne rhizosphere soil as our test system. The 6-carboxyfluorescein (6-FAM)-PSE1284-hybridised population, defined as displaying enhanced green fluorescence in Flow Cytometry, represented 3.51±1.28% of the total detected population when corrected using a nonsense (NON-EUB338) probe control. Analysis of 16S rRNA gene libraries constructed from Fluorescence Activated Cell Sorted (FACS) -recovered fluorescent populations (n=3), revealed that 98.5% (Pseudomonas spp. comprised 68.7% and Burkholderia spp. 29.8%) of the total sorted population was specifically targeted as evidenced by the homology of the 16S rRNA sequences to the probe sequence. In silico evaluation of probe PSE1284 with the use of RDP-10 probeMatch justified the existence of Burkholderia spp. among the sorted cells. The lack of novelty in Pseudomonas spp. sequences uncovered was notable, probably reflecting the well-studied nature of this functionally important genus. To judge the diversity recorded within the FACS-sorted population, rarefaction and DGGE analysis were used to evaluate, respectively, the proportion of Pseudomonas diversity uncovered by the sequencing effort and the representativeness of the Nycodenz® method for the extraction of bacterial cells from soil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An efficient method of combining neutron diffraction data over an extended Q range with detailed atomistic models is presented. A quantitative and qualitative mapping of the organization of the chain conformation in both glass and liquid phase has been performed. The proposed structural refinement method is based on the exploitation of the intrachain features of the diffraction pattern by the use of internal coordinates for bond lengths, valence angles and torsion rotations. Models are built stochastically by assignment of these internal coordinates from probability distributions with limited variable parameters. Variation of these parameters is used in the construction of models that minimize the differences between the observed and calculated structure factors. A series of neutron scattering data of 1,4-polybutadiene at the region 20320 K is presented. Analysis of the experimental data yield bond lengths for C-C and C=C of 1.54 and 1.35 Å respectively. Valence angles of the backbone were found to be at 112 and 122.8 for the CCC and CC=C respectively. Three torsion angles corresponding to the double bond and the adjacent R and β bonds were found to occupy cis and trans, s(, trans and g( and trans states, respectively. We compare our results with theoretical predictions, computer simulations, RIS models, and previously reported experimental results.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel but simple time-of-flight neutron scattering geometry which allows structural anisotropy to be probed directly, simultaneously and thus unambiguously in polymeric and other materials is described. A particular advantage of the simultaneous data collection when coupled to the large area of the beam is that it enables thin films (< 10 μm < 10 mg) to be studied with relative ease. The utility of the technique is illustrated by studies on both deformed poly(styrene) glasses and on thin films of electrical conducting polymers. In the latter case, the power of isotopic substitution is illustrated to great effect. The development of these procedures for use in other areas of materials science is briefly discussed.