73 resultados para NEUTRON-STAR DENSITIES
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
Electrospinning is a technique employed to produce nanoscale to microscale sized fibres by the application of a high voltage to a spinneret containing a polymer solution. Here we examine how small angle neutron scattering data can be modelled to analyse the polymer chain conformation. We prepared 1:1 blends of deuterated and hydrogenated atactic-polystyrene fibres from solutions in N, N-Dimethylformamide and Methyl Ethyl Ketone. The fibres themselves often contain pores or voiding within the internal structure on the length scales that can interfere with scattering experiments. A model to fit the scattering data in order to obtain values for the radius of gyration of the polymer molecules within the fibres has been developed, that includes in the scattering from the voids. Using this model we find that the radius of gyration is 20% larger than in the bulk state and the chains are slightly extended parallel to the fibre axis.
Resumo:
Zn(CN)2 and Ni(CN)2 are known for exhibiting anomalous thermal expansion over a wide temperature range. The volume thermal expansion coefficient for the cubic, three dimensionally connected material, Zn(CN)2, is negative (alpha(V) = −51 10(-6) K-1) while for Ni(CN)2, a tetragonal material, the thermal expansion coefficient is negative in the two dimensionally connected sheets (alpha(a) = −7 10(-6) K-1), but the overall thermal expansion coefficient is positive (alpha(V) = 48 10(-6) K-1). We have measured the temperature dependence of phonon spectra in these compounds and analyzed them using ab initio calculations. The spectra of the two compounds show large differences that cannot be explained by simple mass renormalization of the modes involving Zn (65.38 amu) and Ni (58.69 amu) atoms. This reflects the fact that the structure and bonding are quite different in the two compounds. The calculated pressure dependence of the phonon modes and of the thermal expansion coefficient, alpha(V), are used to understand the anomalous behavior in these compounds. Our ab initio calculations indicate that phonon modes of energy approx. 2 meV are major contributors to negative thermal expansion (NTE) in both the compounds. The low-energy modes of approx.8 and 13 meV in Zn(CN)2 also contribute significantly to the NTE in Zn(CN)2 and Ni(CN)2, respectively. The measured temperature dependence of the phonon spectra has been used to estimate the total anharmonicity of both compounds. For Zn(CN)2, the temperature-dependent measurements (total anharmonicity), along with our previously reported pressure dependence of the phonon spectra (quasiharmonic), is used to separate the explicit temperature effect at constant volume (intrinsic anharmonicity).
Resumo:
This paper presents the theoretical development of a nonlinear adaptive filter based on a concept of filtering by approximated densities (FAD). The most common procedures for nonlinear estimation apply the extended Kalman filter. As opposed to conventional techniques, the proposed recursive algorithm does not require any linearisation. The prediction uses a maximum entropy principle subject to constraints. Thus, the densities created are of an exponential type and depend on a finite number of parameters. The filtering yields recursive equations involving these parameters. The update applies the Bayes theorem. Through simulation on a generic exponential model, the proposed nonlinear filter is implemented and the results prove to be superior to that of the extended Kalman filter and a class of nonlinear filters based on partitioning algorithms.
Resumo:
Many techniques are currently used for motion estimation. In the block-based approaches the most common procedure applied is the block-matching based on various algorithms. To refine the motion estimates resulting from the full search or any coarse search algorithm, one can find few applications of Kalman filtering, mainly in the intraframe scheme. The Kalman filtering technique applicability for block-based motion estimation is rather limited due to discontinuities in the dynamic behaviour of the motion vectors. Therefore, we propose an application of the concept of the filtering by approximated densities (FAD). The FAD, originally introduced to alleviate limitations due to conventional Kalman modelling, is applied to interframe block-motion estimation. This application uses a simple form of FAD involving statistical characteristics of multi-modal distributions up to second order.
Eco-labeling in commercial office markets: do LEED and Energy Star offices obtain multiple premiums?
Resumo:
An efficient method of combining neutron diffraction data over an extended Q range with detailed atomistic models is presented. A quantitative and qualitative mapping of the organization of the chain conformation in both glass and liquid phase has been performed. The proposed structural refinement method is based on the exploitation of the intrachain features of the diffraction pattern by the use of internal coordinates for bond lengths, valence angles and torsion rotations. Models are built stochastically by assignment of these internal coordinates from probability distributions with limited variable parameters. Variation of these parameters is used in the construction of models that minimize the differences between the observed and calculated structure factors. A series of neutron scattering data of 1,4-polybutadiene at the region 20320 K is presented. Analysis of the experimental data yield bond lengths for C-C and C=C of 1.54 and 1.35 Å respectively. Valence angles of the backbone were found to be at 112 and 122.8 for the CCC and CC=C respectively. Three torsion angles corresponding to the double bond and the adjacent R and β bonds were found to occupy cis and trans, s(, trans and g( and trans states, respectively. We compare our results with theoretical predictions, computer simulations, RIS models, and previously reported experimental results.
Resumo:
A novel but simple time-of-flight neutron scattering geometry which allows structural anisotropy to be probed directly, simultaneously and thus unambiguously in polymeric and other materials is described. A particular advantage of the simultaneous data collection when coupled to the large area of the beam is that it enables thin films (< 10 μm < 10 mg) to be studied with relative ease. The utility of the technique is illustrated by studies on both deformed poly(styrene) glasses and on thin films of electrical conducting polymers. In the latter case, the power of isotopic substitution is illustrated to great effect. The development of these procedures for use in other areas of materials science is briefly discussed.