A study by high energy transfer inelastic neutron scattering spectroscopy of the mineral fraction of ox femur bone

We have used high energy transfer (HET) inelastic neutron scattering spectroscopy to measure the vibrational modes in the spectra of hydroxyapatite, bone and brushite to confirm our earlier work that only a fraction of the hydroxyl groups in bone mineral are substituted. The HET spectra are better observed due to the higher scattering cross section of hydrogen compared with the other elements in the calcium phosphate compounds. (C) 2003 Elsevier Science B.V. All rights reserved.

Structure determination from powder diffraction data

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Surface structure of thin asymmetric PS-b-PMMA diblock copolymers investigated by atomic force microscopy

Asymmetric poly(styrene-b-methyl methacrylate) (PS-b-PMMA) diblock copolymers of molecular weight M-n = 29,700g mol(-1) (M-PS = 9300 g mol(-1) M-PMMA = 20,100 g mol(-1), PD = 1.15, chi(PS) = 0.323, chi(PMMA) = 0.677) and M-n = 63,900 g mol(-1) (M-PS = 50,500 g mol(-1), M-PMMA = 13,400 g mol(-1), PD = 1.18, chi(PS) = 0.790, chi(PMMA) = 0.210) were prepared via reversible addition-fragmentation chain transfer (RAFT) polymerization. Atomic force microscopy (AFM) was used to investigate the surface structure of thin films, prepared by spin-coating the diblock copolymers on a silicon substrate. We show that the nanostructure of the diblock copolymer depends on the molecular weight and volume fraction of the diblock copolymers. We observed a perpendicular lamellar structure for the high molar mass sample and a hexagonal-packed cylindrical patterning for the lower molar mass one. Small-angle X-ray scattering investigation of these samples without annealing did not reveal any ordered structure. Annealing of PS-b-PMMA samples at 160 degrees C for 24 h led to a change in surface structure.

Modelling small angle neutron scattering data from electrospun fibres

Electrospinning is a technique employed to produce nanoscale to microscale sized fibres by the application of a high voltage to a spinneret containing a polymer solution. Here we examine how small angle neutron scattering data can be modelled to analyse the polymer chain conformation. We prepared 1:1 blends of deuterated and hydrogenated atactic-polystyrene fibres from solutions in N, N-Dimethylformamide and Methyl Ethyl Ketone. The fibres themselves often contain pores or voiding within the internal structure on the length scales that can interfere with scattering experiments. A model to fit the scattering data in order to obtain values for the radius of gyration of the polymer molecules within the fibres has been developed, that includes in the scattering from the voids. Using this model we find that the radius of gyration is 20% larger than in the bulk state and the chains are slightly extended parallel to the fibre axis.

Relationship between phonons and thermal expansion in Zn(CN)2 and Ni(CN)2 from inelastic neutron scattering and ab initio calculations

Zn(CN)2 and Ni(CN)2 are known for exhibiting anomalous thermal expansion over a wide temperature range. The volume thermal expansion coefficient for the cubic, three dimensionally connected material, Zn(CN)2, is negative (alpha(V) = −51  10(-6) K-1) while for Ni(CN)2, a tetragonal material, the thermal expansion coefficient is negative in the two dimensionally connected sheets (alpha(a) = −7  10(-6) K-1), but the overall thermal expansion coefficient is positive (alpha(V) = 48  10(-6) K-1). We have measured the temperature dependence of phonon spectra in these compounds and analyzed them using ab initio calculations. The spectra of the two compounds show large differences that cannot be explained by simple mass renormalization of the modes involving Zn (65.38 amu) and Ni (58.69 amu) atoms. This reflects the fact that the structure and bonding are quite different in the two compounds. The calculated pressure dependence of the phonon modes and of the thermal expansion coefficient, alpha(V), are used to understand the anomalous behavior in these compounds. Our ab initio calculations indicate that phonon modes of energy approx. 2 meV are major contributors to negative thermal expansion (NTE) in both the compounds. The low-energy modes of approx.8 and 13 meV in Zn(CN)2 also contribute significantly to the NTE in Zn(CN)2 and Ni(CN)2, respectively. The measured temperature dependence of the phonon spectra has been used to estimate the total anharmonicity of both compounds. For Zn(CN)2, the temperature-dependent measurements (total anharmonicity), along with our previously reported pressure dependence of the phonon spectra (quasiharmonic), is used to separate the explicit temperature effect at constant volume (intrinsic anharmonicity).

Extracting quantitative structural parameters for disordered polymers from neutron scattering data

The organization of non-crystalline polymeric materials at a local level, namely on a spatial scale between a few and 100 a, is still unclear in many respects. The determination of the local structure in terms of the configuration and conformation of the polymer chain and of the packing characteristics of the chain in the bulk material represents a challenging problem. Data from wide-angle diffraction experiments are very difficult to interpret due to the very large amount of information that they carry, that is the large number of correlations present in the diffraction patterns.We describe new approaches that permit a detailed analysis of the complex neutron diffraction patterns characterizing polymer melts and glasses. The coupling of different computer modelling strategies with neutron scattering data over a wide Q range allows the extraction of detailed quantitative information on the structural arrangements of the materials of interest. Proceeding from modelling routes as diverse as force field calculations, single-chain modelling and reverse Monte Carlo, we show the successes and pitfalls of each approach in describing model systems, which illustrate the need to attack the data analysis problem simultaneously from several fronts.

Extracting and validating force fields for disordered polymeric materials from neutron scattering data

We present a new approach that allows the determination and refinement of force field parameters for the description of disordered macromolecular systems from experimental neutron diffraction data obtained over a large Q range. The procedure is based on tight coupling between experimentally derived structure factors and computer modelling. By separating the potential into terms representing respectively bond stretching, angle bending and torsional rotation and by treating each of them separately, the various potential parameters are extracted directly from experiment. The procedure is illustrated on molten polytetrafluoroethylene.

Extracting force fields for disordered polymeric materials from neutron scattering data

We present a new approach that allows the determination of force-field parameters for the description of disordered macromolecular systems from experimental neutron diffraction data obtained over a large Q range. The procedure is based on a tight coupling between experimentally derived structure factors and computer modelling. We separate the molecular potential into non-interacting terms representing respectively bond stretching, angle bending and torsional rotation. The parameters for each of the potentials are extracted directly from experimental data through comparison of the experimental structure factor and those derived from atomistic level molecular models. The viability of these force fields is assessed by comparison of predicted large-scale features such as the characteristic ratio. The procedure is illustrated on molten poly(ethylene) and poly(tetrafluoroethylene).

A mechanism for the effect of tropospheric jet structure on the annular mode-like response to stratospheric forcing

For many climate forcings the dominant response of the extratropical circulation is a latitudinal shift of the tropospheric mid-latitude jets. The magnitude of this response appears to depend on climatological jet latitude in general circulation models (GCMs): lower latitude jets exhibit a larger shift. The reason for this latitude dependence is investigated for a particular forcing, heating of the equatorial stratosphere, which shifts the jet poleward. Spin-up ensembles with a simplified GCM are used to examine the evolution of the response for five different jet structures. These differ in the latitude of the eddy-driven jet, but have similar sub-tropical zonal winds. It is found that lower latitude jets exhibit a larger response due to stronger tropospheric eddy-mean flow feedbacks. A dominant feedback responsible for enhancing the poleward shift is an enhanced equatorward refraction of the eddies, resulting in an increased momentum flux, poleward of the low latitude critical line. The sensitivity of feedback strength to jet structure is associated with differences in the coherence of this behaviour across the spectrum of eddy phase speeds. In the configurations used, the higher latitude jets have a wider range of critical latitude locations. This reduces the coherence of the momentum flux anomalies associated with different phase speeds, with low phase speeds opposing the effect of high phase speeds. This suggests that, for a given sub-tropical zonal wind strength, the latitude of the eddy driven jet affects the feedback through its influence on the width of the region of westerly winds and the range of critical latitudes on the equatorward flank of the jet.

Synthesis, crystal structure, and catecholase activity of three trinuclear heterometallic NiII2-MnII complexes derived from a salen-type Schiff base ligand

Three new trinuclear heterometallic nickel(II)manganese(II) complexes, [(NiL)2Mn(NCS)2] (1), [(NiL)2Mn(NCO)2] (2), and [{NiL(EtOH)}2Mn(NO2)2]center dot 2EtOH (3), have been synthesized by using [NiL] as the so-called ligand complex [where H2L = N,N'-bis(salicylidene)-1,3-propanediamine] and have been structurally characterized. Crystal structure analyses revealed that complexes 1 and 2 are angular trinuclear species, in which two terminal four-coordinate square planar [NiL] moieties are coordinated to a central MnII through double phenoxido bridges. The MnII is in a six-coordinate distorted octahedral environment that is bonded additionally to two mutually cis nitrogen atoms of terminal thiocyanate (in 1) and cyanate (in 2). In complex 3, in addition to the double phenoxo bridge, the two terminal NiII ions are linked to the central MnII by means of a nitrite bridge (1?N:2?O) that, together with a coordinated ethanol molecule, gives rise to an octahedral environment around the NiII ions and consequently the structure becomes linear. Catecholase activity of these three complexes was examined by using 3,5-di-tert-butylcatechol (3,5-DTBC) as the substrate. All three complexes mimic catecholase activity and the rate of catechol oxidation follows saturation kinetics with respect to the substrate and first-order kinetics with respect to the catalyst. The EPR spectra of the complexes exhibit characteristic six line spectra, which indicate the presence of high-spin octahedral MnII species in solution state. The ESI-MS positive spectrum of 1 in the presence of 3,5-DTBC has been recorded to investigate possible complexsubstrate intermediates.

A new tetranuclear copper(II) complex with oximate bridges: structure, magnetic properties and DFT study

A new tetranuclear complex, [Cu4L4](ClO4)4·2H2O (1), has been synthesized from the self-assembly of copper(II) perchlorate and the tridentate Schiff base ligand (2E,3E)-3-(2-aminopropylimino) butan-2-one oxime (HL). Single-crystal X-ray diffraction studies reveal that complex 1 consists of a Cu4(NO)4 core where the four copper(II) centers having square pyramidal environment are arranged in a distorted tetrahedral geometry. They are linked together by a rare bridging mode (μ3-η1,η2,η1) of oximato ligands. Analysis of magnetic susceptibility data indicates moderate antiferromagnetic (J1 = −48 cm−1, J2 = −40 cm−1 and J3 = −52 cm−1) exchange interaction through σ-superexchange pathways (in-plane bridging) of the oxime group. Theoretical calculations based on DFT technique have been used to obtain the energy states of different spin configurations and estimate the coupling constants and to understand the exact magnetic exchange pathways.

Spin-canted antiferromagnetic phase transitions in alternating phenoxo- and carboxylato-bridged Mn(III)-salen complexes

Three new MnIII complexes, {[Mn-2(salen)(2)(OCn)](ClO4)}(n) (1), {[Mn-2(salen)(2)(OPh)](ClO4)}(n) (2) and {[Mn-2(salen)(2)(OBz)](ClO4)}(2) (3) (where salen = N,N'-bis(salicylidene)-1,2-diaminoethane dianion, OCn = cinnamate, OPh = phenylacetate and OBz = benzoate), have been synthesized and characterized structurally and magnetically. The crystal structures reveal that all three structures contain syn-anti carboxylatebridged dimeric [Mn-2(salen)(2)(OOCR)](+) cations (OOCR = bridging carboxylate) that are joined together by weak Mn center dot center dot center dot O(phenoxo) interactions to form infinite alternating chain structures in 1 and 2, but the relatively long Mn center dot center dot center dot O(phenoxo) distance [3.621(2)angstrom] in 3 restricts this structure to tetranuclear units. Magnetic studies showed that 1 and 2 exhibited magnetic long-range order at T-N = 4.0 and 4.6 K (T-N = Neel transition temperature), respectively, to give spin-canted antiferromagnetic structures. Antiferromagnetic coupling was also observed in 3 but no peaks were recorded in the field-cooled magnetization (FCM) or zero-field-cooled magnetization (ZFCM) data, indicating that 3 remained paramagnetic down to 2 K. This dominant antiferromagnetic coupling is attributed to the carboxylate bridges. The ferromagnetic coupling expected due to the Mn-O(phenoxo)center dot center dot center dot Mn bridge plays an auxiliary role in the magnetic chain, but is an essential component of the bulk magnetic properties of the material.

Structure and magnetic properties of an unprecedented syn-antiμ-nitrito-1κO:2κO′ bridged Mn(iii)-salen complex and its isoelectronic and isostructural formate analogue

The preparation, crystal structures and magnetic properties of two new isoelectronic and isomorphous formate-and nitrite-bridged 1D chains of Mn(III)-salen complexes, [Mn(salen)(HCOO)](n) (1) and [Mn(salen)(NO2)](n) (2), where salen is the dianion of N,N'-bis(salicylidene)-1,2-diaminoethane, are presented. The structures show that the salen ligand coordinates to the four equatorial sites of the metal ion and the formate or nitrite ions coordinate to the axial positions to bridge the Mn(III)-salen units through a syn-anti mu-1 kappa O:2 kappa O' coordination mode. Such a bridging mode is unprecedented in Mn(III) for formate and in any transition metal ion for nitrite. Variable-temperature magnetic susceptibility measurements of complexes 1 and 2 indicate the presence of ferromagnetic exchange interactions with J values of 0.0607 cm(-1) (for 1) and 0.0883 cm(-1) (for 2). The ac measurements indicate negligible frequency dependence for 1 whereas compound 2 exhibits a decrease of chi(ac)' and a concomitant increase of chi(ac)'' on elevating frequency around 2 K. This finding is an indication of slow magnetization reversal characteristic of single-chain magnets or spin-glasses. The mu-nitrito-1 kappa O:2 kappa O' bridge seems to be a potentially superior magnetic coupler to the formate bridge for the construction of single-molecule/-chain magnets as its coupling constant is greater and the chi(ac)' and chi(ac)'' show frequency dependence.

Structure and magnetic properties of a tetranuclear Cu(II) complex containing the 2-(pyridine-2-yliminomethyl)-phenol ligand

A tetranuclear Cu(II) complex [Cu4L4(H2O)4](ClO4)4 has been synthesized using the terdentate Schiff base 2-(pyridine-2-yliminomethyl)-phenol (HL) (the condensation product of salicylaldehyde and 2-aminopyridine) and copper perchlorate. Chemical characterizations such as IR and UV/Vis of the complex have been carried out. A single-crystal diffraction study shows that the complex contains a nearly planar tetranuclear core containing four copper atoms, which occupy four equivalent five-coordinate sites with a square pyramidal environment. Magnetic measurements have been carried out over the temperature range 2–300K and with 100Oe field strengths. Analysis of magnetic susceptibility data indicates a strong antiferromagnetic (J1=−638cm−1) exchange interaction between diphenoxo-bridged Cu(II) centers and a moderate antiferromagnetic (J2=−34cm−1) interaction between N–C–N bridged Cu(II) centers. Magnetic exchange interactions (J’s) are also discussed on the basis of a computational study using DFT methodology. The spin density distribution (singlet ground state) is calculated to visualize the effect of delocalization of spin density through bridging groups.