Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Modelling small angle neutron scattering data from electrospun fibres

Electrospinning is a technique employed to produce nanoscale to microscale sized fibres by the application of a high voltage to a spinneret containing a polymer solution. Here we examine how small angle neutron scattering data can be modelled to analyse the polymer chain conformation. We prepared 1:1 blends of deuterated and hydrogenated atactic-polystyrene fibres from solutions in N, N-Dimethylformamide and Methyl Ethyl Ketone. The fibres themselves often contain pores or voiding within the internal structure on the length scales that can interfere with scattering experiments. A model to fit the scattering data in order to obtain values for the radius of gyration of the polymer molecules within the fibres has been developed, that includes in the scattering from the voids. Using this model we find that the radius of gyration is 20% larger than in the bulk state and the chains are slightly extended parallel to the fibre axis.

Relationship between phonons and thermal expansion in Zn(CN)2 and Ni(CN)2 from inelastic neutron scattering and ab initio calculations

Zn(CN)2 and Ni(CN)2 are known for exhibiting anomalous thermal expansion over a wide temperature range. The volume thermal expansion coefficient for the cubic, three dimensionally connected material, Zn(CN)2, is negative (alpha(V) = −51  10(-6) K-1) while for Ni(CN)2, a tetragonal material, the thermal expansion coefficient is negative in the two dimensionally connected sheets (alpha(a) = −7  10(-6) K-1), but the overall thermal expansion coefficient is positive (alpha(V) = 48  10(-6) K-1). We have measured the temperature dependence of phonon spectra in these compounds and analyzed them using ab initio calculations. The spectra of the two compounds show large differences that cannot be explained by simple mass renormalization of the modes involving Zn (65.38 amu) and Ni (58.69 amu) atoms. This reflects the fact that the structure and bonding are quite different in the two compounds. The calculated pressure dependence of the phonon modes and of the thermal expansion coefficient, alpha(V), are used to understand the anomalous behavior in these compounds. Our ab initio calculations indicate that phonon modes of energy approx. 2 meV are major contributors to negative thermal expansion (NTE) in both the compounds. The low-energy modes of approx.8 and 13 meV in Zn(CN)2 also contribute significantly to the NTE in Zn(CN)2 and Ni(CN)2, respectively. The measured temperature dependence of the phonon spectra has been used to estimate the total anharmonicity of both compounds. For Zn(CN)2, the temperature-dependent measurements (total anharmonicity), along with our previously reported pressure dependence of the phonon spectra (quasiharmonic), is used to separate the explicit temperature effect at constant volume (intrinsic anharmonicity).

Assessment of CloudSat reflectivity measurements and ice cloud properties using ground-based and airborne cloud radar observations

A quantitative assessment of Cloudsat reflectivities and basic ice cloud properties (cloud base, top, and thickness) is conducted in the present study from both airborne and ground-based observations. Airborne observations allow direct comparisons on a limited number of ocean backscatter and cloud samples, whereas the ground-based observations allow statistical comparisons on much longer time series but with some additional assumptions. Direct comparisons of the ocean backscatter and ice cloud reflectivities measured by an airborne cloud radar and Cloudsat during two field experiments indicate that, on average, Cloudsat measures ocean backscatter 0.4 dB higher and ice cloud reflectivities 1 dB higher than the airborne cloud radar. Five ground-based sites have also been used for a statistical evaluation of the Cloudsat reflectivities and basic cloud properties. From these comparisons, it is found that the weighted-mean difference ZCloudsat − ZGround ranges from −0.4 to +0.3 dB when a ±1-h time lag around the Cloudsat overpass is considered. Given the fact that the airborne and ground-based radar calibration accuracy is about 1 dB, it is concluded that the reflectivities of the spaceborne, airborne, and ground-based radars agree within the expected calibration uncertainties of the airborne and ground-based radars. This result shows that the Cloudsat radar does achieve the claimed sensitivity of around −29 dBZ. Finally, an evaluation of the tropical “convective ice” profiles measured by Cloudsat has been carried out over the tropical site in Darwin, Australia. It is shown that these profiles can be used statistically down to approximately 9-km height (or 4 km above the melting layer) without attenuation and multiple scattering corrections over Darwin. It is difficult to estimate if this result is applicable to all types of deep convective storms in the tropics. However, this first study suggests that the Cloudsat profiles in convective ice need to be corrected for attenuation by supercooled liquid water and ice aggregates/graupel particles and multiple scattering prior to their quantitative use.

Three dimensional picture of the local structure of 1,4-Polybutadiene from a complete atomistic model and neutron scattering data

An efficient method of combining neutron diffraction data over an extended Q range with detailed atomistic models is presented. A quantitative and qualitative mapping of the organization of the chain conformation in both glass and liquid phase has been performed. The proposed structural refinement method is based on the exploitation of the intrachain features of the diffraction pattern by the use of internal coordinates for bond lengths, valence angles and torsion rotations. Models are built stochastically by assignment of these internal coordinates from probability distributions with limited variable parameters. Variation of these parameters is used in the construction of models that minimize the differences between the observed and calculated structure factors. A series of neutron scattering data of 1,4-polybutadiene at the region 20320 K is presented. Analysis of the experimental data yield bond lengths for C-C and C=C of 1.54 and 1.35 Å respectively. Valence angles of the backbone were found to be at 112 and 122.8 for the CCC and CC=C respectively. Three torsion angles corresponding to the double bond and the adjacent R and β bonds were found to occupy cis and trans, s(, trans and g( and trans states, respectively. We compare our results with theoretical predictions, computer simulations, RIS models, and previously reported experimental results.

Exploitation of a pulsed neutron source for the structural study of anisotropic polymer films

A novel but simple time-of-flight neutron scattering geometry which allows structural anisotropy to be probed directly, simultaneously and thus unambiguously in polymeric and other materials is described. A particular advantage of the simultaneous data collection when coupled to the large area of the beam is that it enables thin films (< 10 μm < 10 mg) to be studied with relative ease. The utility of the technique is illustrated by studies on both deformed poly(styrene) glasses and on thin films of electrical conducting polymers. In the latter case, the power of isotopic substitution is illustrated to great effect. The development of these procedures for use in other areas of materials science is briefly discussed.

A complete atomistic model of molten polyethylene from neutron scattering data: a new methodology for polymer structure

A new approach to the study of the local organization in amorphous polymer materials is presented. The method couples neutron diffraction experiments that explore the structure on the spatial scale 1–20 Å with the reverse Monte Carlo fitting procedure to predict structures that accurately represent the experimental scattering results over the whole momentum transfer range explored. Molecular mechanics and molecular dynamics techniques are also used to produce atomistic models independently from any experimental input, thereby providing a test of the viability of the reverse Monte Carlo method in generating realistic models for amorphous polymeric systems. An analysis of the obtained models in terms of single chain properties and of orientational correlations between chain segments is presented. We show the viability of the method with data from molten polyethylene. The analysis derives a model with average C-C and C-H bond lengths of 1.55 Å and 1.1 Å respectively, average backbone valence angle of 112, a torsional angle distribution characterized by a fraction of trans conformers of 0.67 and, finally, a weak interchain orientational correlation at around 4 Å.

A detailed single chain model for molten poly(tetrafluoroethylene) from a novel structure refinement technique on neutron scattering data

We present a new methodology that couples neutron diffraction experiments over a wide Q range with single chain modelling in order to explore, in a quantitative manner, the intrachain organization of non-crystalline polymers. The technique is based on the assignment of parameters describing the chemical, geometric and conformational characteristics of the polymeric chain, and on the variation of these parameters to minimize the difference between the predicted and experimental diffraction patterns. The method is successfully applied to the study of molten poly(tetrafluoroethylene) at two different temperatures, and provides unambiguous information on the configuration of the chain and its degree of flexibility. From analysis of the experimental data a model is derived with CC and CF bond lengths of 1.58 and 1.36 Å, respectively, a backbone valence angle of 110° and a torsional angle distribution which is characterized by four isometric states, namely a split trans state at ± 18°, giving rise to a helical chain conformation, and two gauche states at ± 112°. The probability of trans conformers is 0.86 at T = 350°C, which decreases slightly to 0.84 at T = 400°C. Correspondingly, the chain segments are characterized by long all-trans sequences with random changes in sign, rather anisotropic in nature, which give rise to a rather stiff chain. We compare the results of this quantitative analysis of the experimental scattering data with the theoretical predictions of both force fields and molecular orbital conformation energy calculations.

Extracting quantitative structural parameters for disordered polymers from neutron scattering data

The organization of non-crystalline polymeric materials at a local level, namely on a spatial scale between a few and 100 a, is still unclear in many respects. The determination of the local structure in terms of the configuration and conformation of the polymer chain and of the packing characteristics of the chain in the bulk material represents a challenging problem. Data from wide-angle diffraction experiments are very difficult to interpret due to the very large amount of information that they carry, that is the large number of correlations present in the diffraction patterns.We describe new approaches that permit a detailed analysis of the complex neutron diffraction patterns characterizing polymer melts and glasses. The coupling of different computer modelling strategies with neutron scattering data over a wide Q range allows the extraction of detailed quantitative information on the structural arrangements of the materials of interest. Proceeding from modelling routes as diverse as force field calculations, single-chain modelling and reverse Monte Carlo, we show the successes and pitfalls of each approach in describing model systems, which illustrate the need to attack the data analysis problem simultaneously from several fronts.

Extracting and validating force fields for disordered polymeric materials from neutron scattering data

We present a new approach that allows the determination and refinement of force field parameters for the description of disordered macromolecular systems from experimental neutron diffraction data obtained over a large Q range. The procedure is based on tight coupling between experimentally derived structure factors and computer modelling. By separating the potential into terms representing respectively bond stretching, angle bending and torsional rotation and by treating each of them separately, the various potential parameters are extracted directly from experiment. The procedure is illustrated on molten polytetrafluoroethylene.