79 resultados para NEUTRON EMISSION


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Currently microporous oxidic materials including zeolites are attracting interest as potential hydrogen storage materials. Understanding how molecular hydrogen interacts with these materials is important in the rational development of hydrogen storage materials and is also challenging theoretically. In this paper, we present an incoherent inelastic neutron scattering (INS) study of the adsorption of molecular hydrogen and hydrogen deuteride (HD) in a copper substituted ZSM5 zeolite varying the hydrogen dosage and temperature. We have demonstrated how inelastic neutron scattering can help us understand the interaction of H-2 molecules with a binding site in a particular microporous material, Cu ZSM5, and by implication of other similar materials. The H-2 molecule is bound as a single species lying parallel with the surface. As H-2 dosing increases, lateral interactions between the adsorbed H-2 molecules become apparent. With rising temperature of measurement up to 70 K (the limit of our experiments), H-2 molecules remain bound to the surface equivalent to a liquid or solid H-2 phase. The implication is that hydrogen is bound rather strongly in Cu ZSM5. Using the simple model for the anisotropic interaction to calculate the energy levels splitting, we found that the measured rotational constant of the hydrogen molecule is reduced as a consequence of adsorption by the Cu ZSM5. From the decrease in total signal intensity with increasing temperature, we were able to observe the conversion of para-hydrogen into ortho-hydrogen at paramagnetic centres and so determine the fraction of paramagnetic sites occupied by hydrogen molecules, ca. 60%. (c) 2006 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An inelastic neutron scattering (INS) study of the rotational - vibrational spectrum of dihydrogen sorbed by zeolite X having substituted sodium, calcium and zinc cations is reported. The rotational - vibrational spectrum of H-2 was observed at low energy transfer ( below ca. 25 meV, 202 cm(-1)); the vibration was that of the H-2 molecule against the binding site (H-2 - X, not H - H). The vibration frequency was proportional to the polarising power of the cation (Na+ < Ca2+ < Zn2+). Polarisation of the H-2 molecule dominated the interaction of H-2 with this binding site. The total scattering intensity was proportional to the dihydrogen dose. However the vibrational intensities became constant at ca. 0.3 wt% showing that the H-2 binding sites had saturated. Additional dihydrogen appeared as unbound or weakly bound dihydrogen exhibiting recoil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We report an inelastic neutron scattering (INS) study of the rotational–vibrational spectrum of dihydrogen sorbed by zeolite CaX. In the low energy (<200 cm−1) INS spectrum of adsorbed H2 we observe the rotational–vibrational spectrum of H2, where the vibration is that of the H2 molecule against the binding site (i.e. H2–X, not H–H). We have observed for the first time the vibrational overtones of the hydrogen molecule against the adsorption surface up to sixth order. These vibrations are usually forbidden in INS spectroscopy because of the selection rules imposed by the spin flip event required. In our case we are able to observe such a vibration because the rotational transition J(1 ← 0) convolutes the vibrational spectrum. This paper reports the effect for the first time.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have used high energy transfer (HET) inelastic neutron scattering spectroscopy to measure the vibrational modes in the spectra of hydroxyapatite, bone and brushite to confirm our earlier work that only a fraction of the hydroxyl groups in bone mineral are substituted. The HET spectra are better observed due to the higher scattering cross section of hydrogen compared with the other elements in the calcium phosphate compounds. (C) 2003 Elsevier Science B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Rate coefficients for reactions of nitrate radicals (NO3) with the anthropogenic emissions 2-methylpent-2-ene, (Z)-3-methylpent-2-ene.. ethyl vinyl ether, and the stress-induced plant emission ethyl vinyl ketone (pent-1-en-3-one) were determined to be (9.3 +/- 1.1) x 10(-12), (9.3 +/- 3.2) x 10(-12), (1.7 +/- 1.3) x 10(-12) and (9.4 + 2.7) x 10(-17) cm(3) molecule(-1) s(-1). We performed kinetic experiments at room temperature and atmospheric pressure using a relative-rate technique with GC-FID analysis. Experiments with ethyl vinyl ether required a modification of our established procedure that might introduce additional uncertainties, and the errors suggested reflect these difficulties. Rate coefficients are discussed in terms of electronic and steric influences. Atmospheric lifetimes with respect to important oxidants in the troposphere were calculated. NO3-initiated oxidation is found to be the strongly dominating degradation route for 2-methylpent-2-ene, (Z)-3-methylpent-2-ene and ethyl vinyl ether. Atmospheric concentrations of the alkenes and their relative contribution to the total NMHC emissions from trucks can be expected to increase if plans for the introduction of particle filters for diesel engines are implemented on a global scale. Thus more kinetic data are required to better evaluate the impact of these emissions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Electrospinning is a technique employed to produce nanoscale to microscale sized fibres by the application of a high voltage to a spinneret containing a polymer solution. Here we examine how small angle neutron scattering data can be modelled to analyse the polymer chain conformation. We prepared 1:1 blends of deuterated and hydrogenated atactic-polystyrene fibres from solutions in N, N-Dimethylformamide and Methyl Ethyl Ketone. The fibres themselves often contain pores or voiding within the internal structure on the length scales that can interfere with scattering experiments. A model to fit the scattering data in order to obtain values for the radius of gyration of the polymer molecules within the fibres has been developed, that includes in the scattering from the voids. Using this model we find that the radius of gyration is 20% larger than in the bulk state and the chains are slightly extended parallel to the fibre axis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Zn(CN)2 and Ni(CN)2 are known for exhibiting anomalous thermal expansion over a wide temperature range. The volume thermal expansion coefficient for the cubic, three dimensionally connected material, Zn(CN)2, is negative (alpha(V) = −51  10(-6) K-1) while for Ni(CN)2, a tetragonal material, the thermal expansion coefficient is negative in the two dimensionally connected sheets (alpha(a) = −7  10(-6) K-1), but the overall thermal expansion coefficient is positive (alpha(V) = 48  10(-6) K-1). We have measured the temperature dependence of phonon spectra in these compounds and analyzed them using ab initio calculations. The spectra of the two compounds show large differences that cannot be explained by simple mass renormalization of the modes involving Zn (65.38 amu) and Ni (58.69 amu) atoms. This reflects the fact that the structure and bonding are quite different in the two compounds. The calculated pressure dependence of the phonon modes and of the thermal expansion coefficient, alpha(V), are used to understand the anomalous behavior in these compounds. Our ab initio calculations indicate that phonon modes of energy approx. 2 meV are major contributors to negative thermal expansion (NTE) in both the compounds. The low-energy modes of approx.8 and 13 meV in Zn(CN)2 also contribute significantly to the NTE in Zn(CN)2 and Ni(CN)2, respectively. The measured temperature dependence of the phonon spectra has been used to estimate the total anharmonicity of both compounds. For Zn(CN)2, the temperature-dependent measurements (total anharmonicity), along with our previously reported pressure dependence of the phonon spectra (quasiharmonic), is used to separate the explicit temperature effect at constant volume (intrinsic anharmonicity).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A dynamic, mechanistic model of enteric fermentation was used to investigate the effect of type and quality of grass forage, dry matter intake (DMI) and proportion of concentrates in dietary dry matter (DM) on variation in methane (CH(4)) emission from enteric fermentation in dairy cows. The model represents substrate degradation and microbial fermentation processes in rumen and hindgut and, in particular, the effects of type of substrate fermented and of pH oil the production of individual volatile fatty acids and CH, as end-products of fermentation. Effects of type and quality of fresh and ensiled grass were evaluated by distinguishing two N fertilization rates of grassland and two stages of grass maturity. Simulation results indicated a strong impact of the amount and type of grass consumed oil CH(4) emission, with a maximum difference (across all forage types and all levels of DM 1) of 49 and 77% in g CH(4)/kg fat and protein corrected milk (FCM) for diets with a proportion of concentrates in dietary DM of 0.1 and 0.4, respectively (values ranging from 10.2 to 19.5 g CH(4)/kg FCM). The lowest emission was established for early Cut, high fertilized grass silage (GS) and high fertilized grass herbage (GH). The highest emission was found for late cut, low-fertilized GS. The N fertilization rate had the largest impact, followed by stage of grass maturity at harvesting and by the distinction between GH and GS. Emission expressed in g CH(4)/kg FCM declined oil average 14% with an increase of DMI from 14 to 18 kg/day for grass forage diets with a proportion of concentrates of 0.1, and on average 29% with an increase of DMI from 14 to 23 kg/day for diets with a proportion of concentrates of 0.4. Simulation results indicated that a high proportion of concentrates in dietary DM may lead to a further reduction of CH, emission per kg FCM mainly as a result of a higher DM I and milk yield, in comparison to low concentrate diets. Simulation results were evaluated against independent data obtained at three different laboratories in indirect calorimetry trials with COWS consuming GH mainly. The model predicted the average of observed values reasonably, but systematic deviations remained between individual laboratories and root mean squared prediction error was a proportion of 0.12 of the observed mean. Both observed and predicted emission expressed in g CH(4)/kg DM intake decreased upon an increase in dietary N:organic matter (OM) ratio. The model reproduced reasonably well the variation in measured CH, emission in cattle sheds oil Dutch dairy farms and indicated that oil average a fraction of 0.28 of the total emissions must have originated from manure under these circumstances.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An efficient method of combining neutron diffraction data over an extended Q range with detailed atomistic models is presented. A quantitative and qualitative mapping of the organization of the chain conformation in both glass and liquid phase has been performed. The proposed structural refinement method is based on the exploitation of the intrachain features of the diffraction pattern by the use of internal coordinates for bond lengths, valence angles and torsion rotations. Models are built stochastically by assignment of these internal coordinates from probability distributions with limited variable parameters. Variation of these parameters is used in the construction of models that minimize the differences between the observed and calculated structure factors. A series of neutron scattering data of 1,4-polybutadiene at the region 20320 K is presented. Analysis of the experimental data yield bond lengths for C-C and C=C of 1.54 and 1.35 Å respectively. Valence angles of the backbone were found to be at 112 and 122.8 for the CCC and CC=C respectively. Three torsion angles corresponding to the double bond and the adjacent R and β bonds were found to occupy cis and trans, s(, trans and g( and trans states, respectively. We compare our results with theoretical predictions, computer simulations, RIS models, and previously reported experimental results.