101 resultados para Mild solutions


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The phase separation behaviour in aqueous mixtures of poly(methyl vinyl ether) and hydroxypropylcellulose has been studied by cloud points method and viscometric measurements. The miscibility of these blends in solid state has been assessed by infrared spectroscopy; methanol vapours sorption experiments and scanning electron microscopy. The values of Gibbs energy of mixing of the polymers and their blends with methanol as well as between each other were calculated. It was found that in solid state the polymers can interact with methanol very well but the polymer-polymer interactions are unfavourable. Although in aqueous solutions the polymers exhibit some intermolecular interactions their solid blends are not completely miscible. (C) 2005 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The interactions between hydroxypropylmethylcellulose (HPMC) and poly(acrylic acid) (PAA) as well as poly(methacrylic acid) (PMMA) resulting in formation of hydrophobic interpolymer complexes (IPC) via hydrogen bonding have been studied in aqueous solutions in acidic medium. The formation of IPC of two different compositions (2:1 and 4:1) has been detected for complexes of PAA and HPMC. The critical pH values for complexation of HPMC with PAA and PMAA were determined by the turbidimetric method. It was found that PAA shows the lower complexation ability compared to PMAA due to the more hydrophobic nature of the latter polyacid. The temperature-induced phase separation in HPMC-PAA solution mixtures depends greatly on the components ratio and PAA molecular weight. The complexation ability of hydroxypropylmethylcellulose with respect to poly(acrylic acid) was found to be similar to the complexation ability of methylcellulose, lower than that of hydroxypropylcellulose and higher than that of hydroxyethylcellulose. (c) 2006 Society of Chemical Industry.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Hydrophilic polymeric films based on blends of hydroxyethylcellulose and maleic acid-co-methyl vinyl ether were produced by casting from aqueous solutions. The physicochemical properties of the blends have been assessed using Fourier transform infrared spectroscopy, thermal gravimetric analysis, differential scanning calorimetry, dielectric spectroscopy, etc. The pristine films exhibit complete miscibility due to the formation of intermacromolecular hydrogen bonding. The thermal treatment of the blend films leads to cross-linking via intermacromolecular esterification and anhydride formation. The cross-linked materials are able to swell in water and their swelling degree can be easily controlled by temperature and thermal treatment time. The formation of the crosslinks is apparent in the dynamic properties of the blends as observed through the mechanical relaxation and dielectric relaxation spectra. The dielectric characteristics of the material are influenced by the effects of change in the local structure of the blend on the ionic conduction processes and the rate of dipolar relaxation. Separation of these processes is attempted using the dielectric modulus method. Significant deviations from a simple additive rule of mixing on the activation energy are observed consistent with hydrogen bonding and crosslinking of the matrix. This paper indicates a method for the creation of films with good mechanical and physical characteristics by exposing the blends to a relatively mild thermal treatment.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous research demonstrates that dementia of the Alzheimer type (DAT) is characterised by deficits of episodic memory, especially in the acquisition of new material. As well as this deficit in acquisition, some researchers have also argued for a deficit in consolidation in DAT. We examined acquisition and consolidation by measuring the intertrial gained and lost access in DAT, Mild Cognitive Impairment (MCI) and controls. We report findings from a study of clinical data based on assessment of patients using three free recall trials of a word list. We found that both DAT and MCI groups showed a deficit in acquisition and consolidation of items between trials relative to controls. Moreover, the DAT group was significantly impaired relative to the MCI group for both acquisition and consolidation. Correlations within each group showed that there were strong relationships between intertrial measures and standard measures of memory function. Importantly in no group was there a significant correlation between our measures of acquisition and consolidation: we argue that these measures reflect different underlying processes, and the failure to consolidate in DAT and MCI is not related to the deficit in acquisition. Finally, we showed strong correlations between our measure and dementia severity, suggesting that acquisition and consolidation both get worse as the dementia progresses.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper examines optimal solutions of control systems with drift defined on the orthonormal frame bundle of particular Riemannian manifolds of constant curvature. The manifolds considered here are the space forms Euclidean space E-3, the spheres S-3 and the hyperboloids H-3 with the corresponding frame bundles equal to the Euclidean group of motions SE(3), the rotation group SO(4) and the Lorentz group SO(1,3). The optimal controls of these systems are solved explicitly in terms of elliptic functions. In this paper, a geometric interpretation of the extremal solutions is given with particular emphasis to a singularity in the explicit solutions. Using a reduced form of the Casimir functions the geometry of these solutions are illustrated.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A finite-difference scheme based on flux difference splitting is presented for the solution of the two-dimensional shallow-water equations of ideal fluid flow. A linearised problem, analogous to that of Riemann for gasdynamics, is defined and a scheme, based on numerical characteristic decomposition, is presented for obtaining approximate solutions to the linearised problem. The method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second-order scheme which avoids non-physical, spurious oscillations. An extension to the two-dimensional equations with source terms, is included. The scheme is applied to a dam-break problem with cylindrical symmetry.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A one-dimensional shock (bore) reflection problem is discussed for the two-dimensional shallow water equations with cylindrical symmetry. The differential equations for a similarity solution are derived and solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Solutions of a two-dimensional dam break problem are presented for two tailwater/reservoir height ratios. The numerical scheme used is an extension of one previously given by the author [J. Hyd. Res. 26(3), 293–306 (1988)], and is based on numerical characteristic decomposition. Thus approximate solutions are obtained via linearised problems, and the method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second order scheme which avoids non-physical, spurious oscillations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A one-dimensional shock-reflection test problem in the case of slab, cylindrical or spherical symmetry is discussed for multi-component flows. The differential equations for a similarity solution are derived and then solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper represents the last technical contribution of Professor Patrick Parks before his untimely death in February 1995. The remaining authors of the paper, which was subsequently completed, wish to dedicate the article to Patrick. A frequency criterion for the stability of solutions of linear difference equations with periodic coefficients is established. The stability criterion is based on a consideration of the behaviour of a frequency hodograph with respect to the origin of coordinates in the complex plane. The formulation of this criterion does not depend on the order of the difference equation.