100 resultados para Informatics solutions
Resumo:
This paper examines optimal solutions of control systems with drift defined on the orthonormal frame bundle of particular Riemannian manifolds of constant curvature. The manifolds considered here are the space forms Euclidean space E-3, the spheres S-3 and the hyperboloids H-3 with the corresponding frame bundles equal to the Euclidean group of motions SE(3), the rotation group SO(4) and the Lorentz group SO(1,3). The optimal controls of these systems are solved explicitly in terms of elliptic functions. In this paper, a geometric interpretation of the extremal solutions is given with particular emphasis to a singularity in the explicit solutions. Using a reduced form of the Casimir functions the geometry of these solutions are illustrated.
Resumo:
Nowadays the use of information and communication technology is becoming prevalent in many aspects of healthcare services from patient registration, to consultation, treatment and pathology tests request. Manual interface techniques have dominated data-capture activities in primary care and secondary care settings for decades. Despites the improvements made in IT, usability issues still remain over the use of I/O devices like the computer keyboard, touch-sensitive screens, light pen and barcodes. Furthermore, clinicians have to use several computer applications when providing healthcare services to patients. One of the problems faced by medical professionals is the lack of data integrity between the different software applications which in turn can hinder the provision of healthcare services tailored to the needs of the patients. The use of digital pen and paper technology integrated with legacy medical systems hold the promise of improving healthcare quality. This paper discusses the issue of data integrity in e-health systems and proposes the modelling of "Smart Forms" via semiotics to potentially improve integrity between legacy systems, making the work of medical professionals easier and improve the quality of care in primary care practices and hospitals.
Resumo:
This paper argues the need for the information communication technology (ICT), labor exchange (job boards), and Human Capital ontology engineers (ontoEngineers) to jointly design and socialize an upper level meta-ontology for people readiness and career portability. These enticing ontology research topics have yielded "independent" results, but have yet to meet the more broader or "universal" requirement that emerging frameworks demand. This paper will focus on the need to universally develop an upper level ontology and provide the reader concepts and models that can be transformed into marketable solutions.
Resumo:
Synchronous collaborative systems allow geographically distributed participants to form a virtual work environment enabling cooperation between peers and enriching the human interaction. The technology facilitating this interaction has been studied for several years and various solutions can be found at present. In this paper, we discuss our experiences with one such widely adopted technology, namely the Access Grid. We describe our experiences with using this technology, identify key problem areas and propose our solution to tackle these issues appropriately. Moreover, we propose the integration of Access Grid with an Application Sharing tool, developed by the authors. Our approach allows these integrated tools to utilise the enhanced features provided by our underlying dynamic transport layer.
Resumo:
A finite-difference scheme based on flux difference splitting is presented for the solution of the two-dimensional shallow-water equations of ideal fluid flow. A linearised problem, analogous to that of Riemann for gasdynamics, is defined and a scheme, based on numerical characteristic decomposition, is presented for obtaining approximate solutions to the linearised problem. The method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second-order scheme which avoids non-physical, spurious oscillations. An extension to the two-dimensional equations with source terms, is included. The scheme is applied to a dam-break problem with cylindrical symmetry.
Resumo:
A one-dimensional shock (bore) reflection problem is discussed for the two-dimensional shallow water equations with cylindrical symmetry. The differential equations for a similarity solution are derived and solved numerically in conjunction with the Rankine-Hugoniot shock relations.
Resumo:
Solutions of a two-dimensional dam break problem are presented for two tailwater/reservoir height ratios. The numerical scheme used is an extension of one previously given by the author [J. Hyd. Res. 26(3), 293–306 (1988)], and is based on numerical characteristic decomposition. Thus approximate solutions are obtained via linearised problems, and the method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second order scheme which avoids non-physical, spurious oscillations.
Resumo:
A one-dimensional shock-reflection test problem in the case of slab, cylindrical or spherical symmetry is discussed for multi-component flows. The differential equations for a similarity solution are derived and then solved numerically in conjunction with the Rankine-Hugoniot shock relations.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.
Resumo:
This paper represents the last technical contribution of Professor Patrick Parks before his untimely death in February 1995. The remaining authors of the paper, which was subsequently completed, wish to dedicate the article to Patrick. A frequency criterion for the stability of solutions of linear difference equations with periodic coefficients is established. The stability criterion is based on a consideration of the behaviour of a frequency hodograph with respect to the origin of coordinates in the complex plane. The formulation of this criterion does not depend on the order of the difference equation.
Resumo:
In the present paper, we studied the preparation of biomimetic triblock copolymer (ABA) membranes in aqueous solution and their deposition into solid supports. The self-assembly structures of the ABA in aqueous solution was investigated by using optical microscopy, dynamic light scattering, electron microscopy (EM) and SAXS. Spherical and tubular polymersomes were found at the highest concentrations investigated. The mechanism of deposition on solid supports (mica and glass) was elucidated by using atomic force microscopy (AFM). The deposition results in the formation of a uniform defect-free membrane at suitable polymer concentrations.