126 resultados para Farquhar, Ray
Resumo:
The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.
Resumo:
Solvent influences on the crystallization of polymorph and hydrate forms of the nootropic drug piracetam (2-oxo-pyrrolidineacetamide) were investigated from water, methanol, 2-propanol, isobutanol, and nitromethane. Crystal growth profiles of piracetam polymorphs were constructed using time-resolved diffraction snapshots collected for each solvent system. Measurements were performed by in situ energy dispersive X-ray diffraction recorded in Station 16.4 at the synchrotron radiation source (SRS) at Daresbury Laboratory, CCLRC UK. Crystallizations from methanol, 2-propanol, isobutanol, and nitromethane progressed in a similar fashion with the initial formation of form I which then converted relatively quickly to form II with form III being generated upon further cooling. However, considerable differences were observed for the polymorphs lifetime and both the rate and temperature of conversion using the different solvents. The thermodynamically unstable form I was kinetically favored in isobutanol and nitromethane where traces of this polymorph were observed below 10 degrees C. In contrast, the transformation of form II and subsequent growth of form III were inhibited in 2-propanol and nitromethane solutions. Aqueous solutions produced hydrate forms of piracetam which are different from the reported monohydrate; this crystallization evolved through successive generation of transient structures which transformed upon exchange of intramolecular water between the liquid and crystalline phases. (c) 2007 Wiley-Liss, Inc. and the American Pharmacists Association J Pharm Sci 96:1069-1078, 2007.
Resumo:
This paper describes a method for reconstructing 3D frontier points, contour generators and surfaces of anatomical objects or smooth surfaces from a small number, e. g. 10, of conventional 2D X-ray images. The X-ray images are taken at different viewing directions with full prior knowledge of the X-ray source and sensor configurations. Unlike previous works, we empirically demonstrate that if the viewing directions are uniformly distributed around the object's viewing sphere, then the reconstructed 3D points automatically cluster closely on a highly curved part of the surface and are widely spread on smooth or flat parts. The advantage of this property is that the reconstructed points along a surface or a contour generator are not under-sampled or under-represented because surfaces or contours should be sampled or represented with more densely points where their curvatures are high. The more complex the contour's shape, the greater is the number of points required, but the greater the number of points is automatically generated by the proposed method. Given that the number of viewing directions is fixed and the viewing directions are uniformly distributed, the number and distribution of the reconstructed points depend on the shape or the curvature of the surface regardless of the size of the surface or the size of the object. The technique may be used not only in medicine but also in industrial applications.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The cloud-air transition zone at stratiform cloud edges is an electrically active region where droplet charging has been predicted. Cloud edge droplet charging is expected from vertical flow of cosmic ray generated atmospheric ions in the global electric circuit. Experimental confirmation of stratiform cloud edge electrification is presented here, through charge and droplet measurements made within an extensive layer of supercooled stratiform cloud, using a specially designed electrostatic sensor. Negative space charge up to 35 pC m−3 was found in a thin (<100 m) layer at the lower cloud boundary associated with the clear air-cloud conductivity gradient, agreeing closely with space charge predicted from the measured droplet concentration using ion-aerosol theory. Such charge levels carried by droplets are sufficient to influence collision processes between cloud droplets.
Resumo:
The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.
Resumo:
WThe capillary flow alignment of the thermotropic liquid crystal 4-n-octyl-4′-cyanobiphenyl in the nematic and smectic phases is investigated using time-resolved synchrotron small-angle x-ray scattering. Samples were cooled from the isotropic phase to erase prior orientation. Upon cooling through the nematic phase under Poiseuille flow in a circular capillary, a transition from the alignment of mesogens along the flow direction to the alignment of layers along the flow direction (mesogens perpendicular to flow) appears to occur continuously at the cooling rate applied. The transition is centered on a temperature at which the Leslie viscosity coefficient α3 changes sign. The configuration with layers aligned along the flow direction is also observed in the smectic phase. The transition in the nematic phase on cooling has previously been ascribed to an aligning-nonaligning or tumbling transition. At high flow rates there is evidence for tumbling around an average alignment of layers along the flow direction. At lower flow rates this orientation is more clearly defined. The layer alignment is ascribed to surface-induced ordering propagating into the bulk of the capillary, an observation supported by the parallel alignment of layers observed for a static sample at low temperatures in the nematic phase.
Resumo:
The novel cryptand in/out-3, containing two tripyrrolemethane units briged by three 1,3- diisopropylidenbenzene arms was readily synthesized by a convergent three-step synthesis. It binds fluoride by inclusion with excellent selectivity with respect to a number of other tested anions. The structure of the free receptor and that of its fluoride complex were investigated in solution by NMR spectroscopy. The solid state X-ray structure of the free cryptand 3 was also determined.
Resumo:
A program is provided to determine structural parameters of atoms in or adsorbed on surfaces by refinement of atomistic models towards experimentally determined data generated by the normal incidence X-ray standing wave (NIXSW) technique. The method employs a combination of Differential Evolution Genetic Algorithms and Steepest Descent Line Minimisations to provide a fast, reliable and user friendly tool for experimentalists to interpret complex multidimensional NIXSW data sets.
Resumo:
The lithium salt of the anionic SPS pincer ligand composed of a central hypervalent lambda(4)-phosphinine ring bearing two ortho-positioned diphenylphosphine sulfide side arms reacts with [Mn(CO)(5)Br] to give fac-[Mn(SPS)(CO)(3)], This isomer can be converted photochemicaily to mer-[Mn(SPS)(CO)(3)], with a very high quantum yield (0.80 +/- 0.05). The thermal backreaction is slow (taking ca. 8 h at room temperature), in contrast to rapid electrodecatalyzed mer-to-fac isomerization triggered by electrochemical reduction of mer-[Mn(SPS)(CO)(3)]. Both geometric isomers of [Mn(SPS)(CO)(3)] have been characterized by X-ray crystallography. Both isomers show luminescence from a low-lying (IL)-I-3 (SPS-based) excited state. The light emission of fac-[Mn(SPS)(CO)(3)] is largely quenched by the efficient photoisomerization occurring probably from a low-lying Mn-CO dissociative excited state. Density functional theory (DFT) and time-dependent DFT calculations describe the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) of fac- and mer-[Mn(CO)(3)(SPS)] as ligand-centered orbitals, largely localized on the phosphinine ring of the SPS pincer ligand. In line with the ligand nature of its frontier orbitals, fac-[Mn(SPS)(CO)(3)] is electrochemically reversibly oxidized and reduced to the corresponding radical cation and anion, respectively. The spectroscopic (electron paramagnetic resonance, IR, and UV-vis) characterization of the radical species provides other evidence for the localization of the redox steps on the SIPS ligand. The smaller HOMO-LUMO energy difference in the case of mer-[Mn(CO)(3)(SPS)], reflected in the electronic absorption and emission spectra, corresponds with its lower oxidation potential compared to that of the fac isomer. The thermodynamic instability of mer-[Mn(CO)(3)(SPS)], confirmed by the DFT calculations, increases upon one-electron reduction and oxidation of the complex.
Resumo:
Two vertical cosmic ray telescopes for atmospheric cosmic ray ionization event detection are compared. Counter A, designed for low power remote use, was deployed in the Welsh mountains; its event rate increased with altitude as expected from atmospheric cosmic ray absorption. Independently, Counter B’s event rate was found to vary with incoming particle acceptance angle. Simultaneous colocated comparison of both telescopes exposed to atmospheric ionization showed a linear relationship between their event rates.
Resumo:
YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.
Resumo:
Measurements of the ionospheric E-region during total solar eclipses have been used to provide information about the evolution of the solar magnetic field and EUV and X-ray emissions from the solar corona and chromosphere. By measuring levels of ionisation during an eclipse and comparing these measurements with an estimate of the unperturbed ionisation levels (such as those made during a control day, where available) it is possible to estimate the percentage of ionising radiation being emitted by the solar corona and chromosphere. Previously unpublished data from the two eclipses presented here are particularly valuable as they provide information that supplements the data published to date. The eclipse of 23 October 1976 over Australia provides information in a data gap that would otherwise have spanned the years 1966 to 1991. The eclipse of 4 December 2002 over Southern Africa is important as it extends the published sequence of measurements. Comparing measurements from eclipses between 1932 and 2002 with the solar magnetic source flux reveals that changes in the solar EUV and X-ray flux lag the open source flux measurements by approximately 1.5 years. We suggest that this unexpected result comes about from changes to the relative size of the limb corona between eclipses, with the lag representing the time taken to populate the coronal field with plasma hot enough to emit the EUV and X-rays ionising our atmosphere.