Modeling the structure of amorphous MoS3: a neutron diffraction and reverse Monte Carlo study

A model for the structure of amorphous molybdenum trisulfide, a-MoS3, has been created using reverse Monte Carlo methods. This model, which consists of chains Of MoS6 units sharing three sulfurs with each of its two neighbors and forming alternate long, nonbonded, and short, bonded, Mo-Mo separations, is a good fit to the neutron diffraction data and is chemically and physically realistic. The paper identifies the limitations of previous models based on Mo-3 triangular clusters in accounting for the available experimental data.

ExtSym: a program to aid space-group determination from powder diffraction data

Once unit-cell dimensions have been determined from a powder diffraction data set and therefore the crystal system is known (e.g. orthorhombic), the method presented by Markvardsen, David, Johnson & Shankland [Acta Cryst. (2001), A57, 47-54] can be used to generate a table ranking the extinction symbols of the given crystal system according to probability. Markvardsen et al. tested a computer program (ExtSym) implementing the method against Pawley refinement outputs generated using the TF12LS program [David, Ibberson & Matthewman (1992). Report RAL-92-032. Rutherford Appleton Laboratory, Chilton, Didcot, Oxon, UK]. Here, it is shown that ExtSym can be used successfully with many well known powder diffraction analysis packages, namely DASH [David, Shankland, van de Streek, Pidcock, Motherwell & Cole (2006). J. Appl. Cryst. 39, 910-915], FullProf [Rodriguez-Carvajal (1993). Physica B, 192, 55-69], GSAS [Larson & Von Dreele (1994). Report LAUR 86-748. Los Alamos National Laboratory, New Mexico, USA], PRODD [Wright (2004). Z. Kristallogr. 219, 1-11] and TOPAS [Coelho (2003). Bruker AXS GmbH, Karlsruhe, Germany]. In addition, a precise description of the optimal input for ExtSym is given to enable other software packages to interface with ExtSym and to allow the improvement/modification of existing interfacing scripts. ExtSym takes as input the powder data in the form of integrated intensities and error estimates for these intensities. The output returned by ExtSym is demonstrated to be strongly dependent on the accuracy of these error estimates and the reason for this is explained. ExtSym is tested against a wide range of data sets, confirming the algorithm to be very successful at ranking the published extinction symbol as the most likely. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved.

Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

A differential thermal expansion approach to crystal structure determination from powder diffraction data

Differential thermal expansion over the range 90-210 K has been applied successfully to determine the crystal structure of chlorothiazide from synchrotron powder diffraction data using direct methods. Key to the success of the approach is the use of a multi-data-set Pawley refinement to extract a set of reflection intensities that is more 'single-crystal-like' than those extracted from a single data set. The improvement in reflection intensity estimates is quantified by comparison with reference single-crystal intensities. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved

Structure determination from powder diffraction data

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Jpowder: a Java-based program for the display and examination of powder diffraction data

The ability to display and inspect powder diffraction data quickly and efficiently is a central part of the data analysis process. Whilst many computer programs are capable of displaying powder data, their focus is typically on advanced operations such as structure solution or Rietveld refinement. This article describes a lightweight software package, Jpowder, whose focus is fast and convenient visualization and comparison of powder data sets in a variety of formats from computers with network access. Jpowder is written in Java and uses its associated Web Start technology to allow ‘single-click deployment’ from a web page, http://www.jpowder.org. Jpowder is open source, free and available for use by anyone.

Structure of single-wall peptide nanotubes: in situ flow aligning X-ray diffraction

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Energy-dependent cancellation of diffraction spots due to surface roughening

The low-energy electron diffraction (LEED) pattern of the step-kinked Pt{531} surface at 200 K shows energy-dependent cancellation of diffraction spots over unusually large energy ranges, up to 100 eV. This cannot be reproduced theoretically when a flat surface geometry is assumed. A relatively simple model of roughening, however, involving 0.25 ML of vacancies and adatoms leads to very good agreement with the experiment. The cancellation of intensities within a very narrow range of adatom or vacancy coverages is caused by the interference of electrons emerging from different heights but similar local environments. This is a rare example where the energy dependence of integrated LEED spot intensities is dramatically affected by the long-range arrangement of atoms.

Molecular t-matrices for low-energy electron diffraction (TMOL v1.1)*1

We describe a FORTRAN-90 program that computes scattering t-matrices for a molecule. These can be used in a Low-Energy Electron Diffraction program to solve the molecular structural problem very efficiently. The intramolecular multiple scattering is computed within a Dyson-like approach, using free space Green propagators in a basis of spherical waves. The advantage of this approach is related to exploiting the chemical identity of the molecule, and to the simplicity to translate and rotate these t-matrices without performing a new multiple-scattering calculation for each configuration. FORTRAN-90 routines for rotating the resulting t-matrices using Wigner matrices are also provided.

A FORTRAN-90 low-energy electron diffraction program (LEED90 v1.1)

We describe a FORTRAN-90 program to compute low-energy electron diffraction I(V) curves. Plane-waves and layer doubling are used to compute the inter-layer multiple-scattering, while the intra-layer multiple-scattering is computed in the standard way expanding the wavefield on a basis of spherical waves. The program is kept as general as possible, in order to allow testing different parts of multiple-scattering calculations. In particular, it can handle non-diagonal t-matrices describing the scattering of non-spherical potentials, anisotropic vibrations, anharmonicity, etc. The program does not use old FORTRAN flavours, and has been written keeping in mind the advantage for parallelism brought forward by FORTRAN-90.

Chestnut and mimosa tannin silages: Effects in sheep differ for apparent digestibility, nitrogen utilisation and losses

This paper reports effects of chestnut and mimosa tannins on N utilisation in sheep. Tannins were added to grass either at ensilage or incorporated into grass silage at feeding. The study used an 8 × 5 incomplete Latin Square design with eight mature wether sheep and five 21-day periods. Tannin additions reduced in vivo apparent digestibilities of dry matter (DM), organic matter (OM) and neutral detergent fibre (aNDFom) compared with the untreated control silage (P<0.001). Reductions ranged from 7.6% for DM to 8.5% for aNDFom. Chestnut compared to mimosa tannin silages produced higher values for DM intake (734 g/day versus 625 g/day) and in vivo digestibility for DM, OM and aNDFom (0.66, 0.68 and 0.69 versus 0.61, 0.63 and 0.62; P<0.001). A substantial shift occurred in the pattern of N excretion in sheep fed the tannin versus control silages. As a proportion of daily N intake, urinary N losses were lower (56.4 g/100 g N versus 65.1 g/100 g N intake) and faecal N losses were higher (40.2 g/100 g N versus 29.8 g/100 g N intake) for sheep fed the tannin silages compared with those fed the control grass silage (P<0.001). Nitrogen intake was higher in sheep fed the chestnut compared to mimosa tannin silages (16.2 g/day versus 13.4 g/day; P<0.001), reflecting the lower DM intake of sheep fed the mimosa silages. However, faecal N loss was lower for chestnut compared to mimosa tannin silage fed sheep (38.2 g/100 g N versus 42.1 g/100 g N intake; P<0.01), resulting in higher N retentions with the chestnut compared to the mimosa silage fed sheep (5.49 g/100 g N versus 1.38 g/100 g N intake). Faecal N losses were also higher when tannins were added during ensiling rather than at feeding (P<0.05). Although there was no overall effect of tannins on N retention in mature wether sheep, it is likely that productive ruminants with higher protein requirements would retain more N from silages containing chestnut tannins. Tannins added externally to grass silages may generate some benefits on N utilisation and environmental N excretions in sheep fed the silages.

Have increased dissolved organic carbon (DOC) losses from UK peat and organo-mineral soils been driven by the decline in acid rain?

Dissolved organic carbon (DOC) concentrations have been rising in streams and lakes draining catchments with organic soils across Northern Europe. These increases have shown a correlation with decreased sulphate and chloride concentrations. One hypothesis to explain this phenomenon is that these relationships are due an increased in DOC release from soils to freshwaters, caused by a decline in pollutant sulphur and sea-salt deposition. We carried out controlled deposition experiments in the laboratory on intact peat and organomineral O-horizon cores to test this hypothesis. Preliminary data showed a clear correlation between the change in soil water pH and change in DOC concentrations, however uncertainty still remains about whether this is due to changes in biological activity or chemical solubility.

Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.