87 resultados para CALCIUM TUNGSTATE CRYSTALS


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Reaction of single crystals of benzoic and trans-cinnamic acids with 200 Torr pressure of ammonia gas in a sealed glass bulb at 20 degrees C generates the corresponding ammonium salts; there is no sign of any 1:2 adduct as has been reported previously for related systems. Isotopic substitution using ND3 has been used to aid identification of the products. Adipic acid likewise reacts with NH3 gas to form a product in which ammonium salts are formed at both carboxylic acid groups. Reaction of 0.5 Torr pressure of NO2 gas with single crystals of 9-methylanthracene and 9-anthracenemethanol in a flow system generates nitrated products where the nitro group appears to be attached at the 10-position, i.e. the position trans to the methyl or methoxy substituent on the central ring. Isotopic substitution using (NO2)-N-15 has been used to confirm the identity of the bands arising from the coordinated NO2 group. The products formed when single crystals of hydantoin are reacted with NO2 gas under similar conditions depend on the temperature of the reaction. At 20 degrees C, a nitrated product is formed, but at 65 degrees C this gives way to a product containing no nitro groups. The findings show the general applicability of infrared microspectroscopy to a study of gas-solid reactions of organic single crystals. (c) 2005 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Single crystals of trans-cinnamic acid and of a range of derivatives of this compound containing halogen substituents on the aromatic ring have been reacted with 165 Torr pressure of bromine vapour in a sealed desiccator at 20 degrees C for 1 week. Infrared and Raman microspectroscopic examination of the crystals shows that bromination of the aliphatic double bond, but not of the aromatic ring, has occurred. It is demonstrated also that the reaction is truly gas-solid in nature. A time-dependent study of these reactions shows that they do not follow a smooth diffusion-controlled pathway. Rather the reactions appear to be inhomogeneous and to occur at defects within the crystal. The reaction products are seen to flake from the surface of the crystal. It is shown, therefore, that these are not single crystal to single crystal transitions, as have been observed previously for the photodimerisation of trans-cinnamic acid and several of its derivatives. It is shown that there are no by-products of the reaction and that finely ground samples react to form the same products as single crystals.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of metal ions in determining the solution conformation of the Holliday junction is well established, but to date the picture of metal ion binding from structural studies of the four-way DNA junction is very incomplete. Here we present two refined structures of the Holliday junction formed by the sequence d(TCGGTACCGA) in the presence of Na+ and Ca2+, and separately with Sr2+ to resolutions of 1.85 Angstrom and 1.65 Angstrom, respectively. This sequence includes the ACC core found to promote spontaneous junction formation, but its structure has not previously been reported. Almost complete hydration spheres can be defined for each metal cation. The Na+ sites, the most convincing observation of such sites in junctions to date, are one on either face of the junction crossover region, and stabilise the ordered hydration inside the junction arms. The four Ca2+ sites in the same structure are at the CG/CG steps in the minor groove. The Sr2+ ions occupy the TC/AG, GG/CC, and TA/TA sites in the minor groove, giving ten positions forming two spines of ions, spiralling through the minor grooves within each arm of the stacked-X structure. The two structures were solved in the two different C2 lattices previously observed, with the Sr2+ derivative crystallising in the more highly symmetrical form with two-fold symmetry at its centre. Both structures show an opening of the minor groove face of the junction of 8.4degrees in the Ca2+ and Na+ containing structure, and 13.4degrees in the Sr2+ containing structure. The crossover angles at the junction are 39.3degrees and 43.3degrees, respectively. In addition to this, a relative shift in the base pair stack alignment of the arms of 2.3 Angstrom is observed for the Sr2+ containing structure only. Overall these results provide an insight into the so-far elusive stabilising ion structure for the DNA Holliday junction. (C) 2003 Elsevier Science Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Addition of 25 mM calcium chloride to soy milk reduced pH, increased ionic calcium and caused it to coagulate. The effects of different chelating agents were investigated on selected physicochemical properties of soy milk and on preventing coagulation. The soy milks were then pasteurised to examine how heat treatment changed some of these properties as well as to evaluate their effects on heat stability. Sediment formation and susceptibility to coagulation could be reduced by decreasing ionic calcium and increasing pH. To achieve this, the most effective chelating agents were tri-sodium citrate and disodium hydrogen phosphate. These chelating agents also reduce absolute viscosity and particle size. Sodium hexa meta phosphate was also effective, but less so; it reduced ionic calcium but had a less noticeable effect on pH. The disodium salt of ethylenediamine tetraacetic acid was not effective, as it decreased the pH of soy milk. Ionic calcium and pH are useful indicators of heat stability of calcium-fortified soy beverages. (C) 2009 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Soymilks with sodium hexametaphosphate (SHMP) (0% to 1.2%) and calcium chloride (12.50, 18.75, and 25.00 mM Ca),were analyzed for total Ca, Ca ion concentration, pH, kinematic viscosity, particle diameter, and sediment after pasteurization. Higher added Ca led to significant (P <= 0.05) increases in Ca ion concentration and significant (P <= 0.05) decreases in pH. At certain levels of SHMP, higher concentrations of added Ca significantly increased (P <= 0.05) kinematic viscosity, particle diameter, and sediment. Increasing SHMP concentration reduced Ca ion concentration, particle diameter, and dry sediment content, but reduced kinematic viscosity of samples (P <= 0.05). Adding SHMP up to 0.7% influenced pH of soymilk in different ways, depending on the level of Ca addition. When the pH of Ca-fortified soymilk was adjusted to a higher level, ionic Ca decreased as pH increased. Ihere was a negative linear relationship between the logarithm of ionic Ca concentration and the adjusted pH of the soymilk. Ionic Ca appeared to be a good indicator of thermally induced sediment formation, with little sediment being produced if ionic Ca was maintained below 0.4 mM.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

There are many reports in the literature regarding the effects of ionic calcium on reactions related to casein micelle stability, such as heat stability, ethanol stability and susceptibility to gelation, sediment formation and fouling. However, experimental evidence supporting these assertions is much less readily available. This paper evaluates three selective ion electrode systems for measuring ionic calcium directly in milk as well as looking at the effects on pH reduction and addition of calcium chloride. The best electrode system was the Ciba Corning 634 system, which was designed for blood but has been modified for milk. This was found to be reproducible and stable when calibrated daily and allowed direct measurements to be taken on milk in 70 s. This has been found to perform well now for 3 years. The other systems were not so useful, as they took longer to stabilize, but may be useful for higher ionic calcium concentrations, which are found in acidified milk products. Reducing the pH increased ionic calcium and reduced ethanol stability. Calcium chloride addition reduced pH, increased ionic calcium and reduced the ethanol stability. Readjusting the pH to its value before calcium addition reduced the ionic calcium, but not back to its original value. Milks from individual cows showed wide variations in their ionic calcium concentrations. This establishes the methodology for a more detailed investigation on measurement of ionic calcium in milks from individual cows and from bulk milks, to allow a better understanding of its role in casein micelle stability.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Calcium removal, using Duolite C433 ion exchange resin, was faster from permeate than from milk. Almost all calcium could be removed, suggesting a fairly rapid conversion from both soluble calcium phosphate and from micellar calcium to ionic calcium. Calcium reduction from milk is accompanied by an increase in pH, a reduction in ionic calcium, an increase in ethanol stability and an increase in the rennet coagulation time. There is a gradual increase in the average casein micelle size with calcium removal, up to a point where the micelle size increases dramatically. Zeta potential becomes more negative with calcium removal. At higher levels of calcium removal, the changes are not reversible, on reducing pH to its original value. For goat's milk, over the range 0-20% total calcium removal, relatively small reductions in total calcium gave rise to proportionally larger reductions in ionic calcium in a ratio of about 1:3.2.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cationic swede and anionic turnip peroxidases were partially purified by ion-exchange and gel-filtration chromatography, respectively. Heat treatment of these enzymes and of a commercial high purity horseradish peroxidase (HRP) caused a loss of enzyme activity and a corresponding increase in linoleic acid hydroperoxide formation activity. The hydroperoxide levels in model systems increased only in the early stages of the oxidation reaction and then declined as degradation became more significant. The presence of a dialysed blend of cooked swede markedly lowered the hydroperoxide level formed. Analysis of volatile compounds formed showed that hexanal predominated in a buffer system and in a blend of cooked turnip. In dialysed blends of cooked swede, hexanol was the primary volatile compound generated. After inactivation under mild conditions in the presence of EDTA, the peroxidases showed hydroperoxide formation activity and patterns of volatile compounds from linoleic acid that were similar to those found on heat-inactivation. This suggested that calcium abstraction from the peroxidases was critical for the enhancement of lipid oxidation activity. (C) 2002 Elsevier Science Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Neuropathic pain is a difficult state to treat, characterized by alterations in sensory processing that can include allodynia (touch-evoked pain). Evidence exists for nerve damage-induced plasticity in both transmission and modulatory systems, including changes in voltage-dependent calcium channel (VDCC) expression and function; however, the role of Ca(v)2.3 calcium channels has not clearly been defined. Here, the effects of SNX-482, a selective Ca(v)2.3 antagonist, on sensory transmission at the spinal cord level have been investigated in the rat. The spinal nerve ligation (SNL) model of chronic neuropathic pain [Kim & Chung, (1992) Pain, 50, 355-363] was used to induce mechanical allodynia, as tested on the ipsilateral hindpaw. In vivo electrophysiological measurements of dorsal horn neuronal responses to innocuous and noxious electrical and natural stimuli were made after SNL and compared to sham-operated animals. Spinal SNX-482 (0.5-4 mu g/50 mu L) exerted dose-related inhibitions of noxious C-fibre- and A delta-fibre-mediated neuronal responses in conditions of neuropathy, but not in sham-operated animals. Measures of spinal cord hyperexcitability and nociception were most susceptible to SNX-482. In contrast, non-noxious A beta-mediated responses were not affected by SNX-482. Moreover, responses to innocuous mechanical and also thermal stimuli were more sensitive to SNX-482 in SNL than control animals. This study is the first to demonstrate an antinociceptive role for SNX-482-sensitive channels in dorsal horn neurons during neuropathy. These data are consistent with plasticity in Ca(V)2.3 calcium channel expression and suggest a potential selective target to reduce nociceptive transmission during conditions of nerve damage.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Reactions in (molecular) organic crystalline solids have been shown to be important for exerting control that is unattainable over chemical transformations in solution. Such control has also been achieved for reactions within metal– organic cages. In these examples, the reactants are already in place within the crystals following the original crystal growth. The post-synthetic modification of metal–organic frameworks (MOFs and indeed reactions and catalysis within MOFs have been recently demonstrated; in these cases the reactants enter the crystals through permanent channels. Another growing area of interest within molecular solid-state chemistry is synthesis by mechanical co-grinding of solid reactants—often referred to as mechanochemistry. Finally, in a small number of reported examples, molecules also have been shown to enter nonporous crystals directly from the gas or vapor phase, but in only a few of these examples does a change in covalent bonding result, which indicates that a reaction occurs within the nonporous crystals. It is this latter type of highly uncommon reaction that is the focus of the present study.