69 resultados para Binary Colloidal Crystals
Resumo:
The recovery of lactoferrin and lactoperoxidase from sweet whey was studied using colloidal gas aphrons (CGAs), which are surfactant-stabilized microbubbles (10-100 mum). CGAs are generated by intense stirring (8000 rpm for 10 min) of the anionic surfactant AOT (sodium bis-2-ethylhexyl sulfosuccinate). A volume of CGAs (10-30 mL) is mixed with a given volume of whey (1 - 10 mL), and the mixture is allowed to separate into two phases: the aphron (top) phase and the liquid (bottom) phase. Each of the phases is analyzed by SDS-PAGE and surfactant colorimetric assay. A statistical experimental design has been developed to assess the effect of different process parameters including pH, ionic strength, the concentration of surfactant in the CGAs generating solution, the volume of CGAs and the volume of whey on separation efficiency. As expected pH, ionic strength and the volume of whey (i.e. the amount of total protein in the starting material) are the main factors influencing the partitioning of the Lf(.)Lp fraction into the aphron phase. Moreover, it has been demonstrated that best separation performance was achieved at pH = 4 and ionic strength = 0.1 mol/L i.e., with conditions favoring electrostatic interactions between target proteins and CGAs (recovery was 90% and the concentration of lactoferrin and lactoperoxidase in the aphron phase was 25 times higher than that in the liquid phase), whereas conditions favoring hydrophobic interactions (pH close to pI and high ionic strength) led to lower performance. However, under these conditions, as confirmed by zeta potential measurements, the adsorption of both target proteins and contaminant proteins is favored. Thus, low selectivity is achieved at all of the studied conditions. These results confirm the initial hypothesis that CGAs act as ion exchangers and that the selectivity of the process can be manipulated by changing main operating parameters such as type of surfactant, pH and ionic strength.
Resumo:
Colloidal gas aphrons (CGA), which are surfactant stabilised microbubbles, have been previously applied for the recovery of proteins from model mixtures and a few studies have demonstrated the potential of these dispersions for the selective recovery of proteins from complex mixtures. However there is a lack of understanding of the mechanism of separation and forces governing the selectivity of the separation. In this paper a mechanistic study is carried out to determine the main factors and forces influencing the selectivity of separation of whey proteins with CGA generated from ionic surfactants. Two different separation strategies were followed: (i) separation of lactoferrin and lactoperoxidase by anionic CGA generated from a solution of sodium bis-(2-ethyl hexyl) sulfosuccinate (AOT); (ii) separation of beta-lactoglobulin by cationic CGA generated from a solution of cetyltrimethylammonium bromide (CTAB). Separation results indicate that electrostatic interactions are the main forces determining the selectivity however these could not completely explain the selectivities obtained following both strategies. Protein-surfactant interactions were studied by measuring the zeta potential changes on individual proteins upon addition of surfactant and at varying pH. Interestingly strongest electrostatic interactions were measured at those pH and surfactant to protein mass ratios which were optimum for protein separation. Effect of surfactant on protein conformation was determined by measuring the change in fluorescence intensity upon addition of surfactant at varying pH. Differences in the fluorescence patterns were detected among proteins which were correlated to differences in their conformational features which could in turn explain their different separation behaviour. The effect of conformation on selectivity was further proven by experiments in which conformational changes were induced by pre-treatment of whey (heating) and by storage at 4 degrees C. Overall it can be concluded that separation of proteins by ionic CGA is driven mainly by electrostatic interactions however conformational features will finally determine the selectivity of the separation with competitive adsorption having also an effect. (c) 2006 Elsevier B.V. All rights reserved.
Resumo:
The aim of this study is to investigate the mechanism responsible for the recovery of astaxanthin using Colloidal Gas Aphrons (CGA), which are surfactant stabilised microbubbles. The latter were produced using different surfactant solutions (Cetyl Trimethyl Ammonium Bromide (CTAB)-cationic, Sodium Dodecyl Sulfate (SDS)-anionic, TWEEN 60-non-ionic and mixtures of TWEEN 60-SPAN 80- non-ionic with varying hydrophobicity) at stirring speed 8000 rpm and stirring time 5 min. Experiments were carried out at varying pH and volumetric ratios of astaxanthin to CGA, and with two different astaxanthin standard suspensions: (i) astaxanthin dispersed in aqueous solutions and (ii) astaxanthin dispersed in ethanolic/aqueous solutions with different compositions of ethanol (20/80 (v/v) and 40/60 (v/v)). When astaxanthin is dispersed in aqueous solutions the separation seems to occur mainly by electrostatic interactions. Therefore the recoveries are higher in the case of the cationic surfactant when astaxanthin particles are strongly negatively charged, as shown by the zeta potential measurements. When ethanol is present, highest recoveries are achieved with CGA produced from the non-ionic surfactant, which indicates that, under these conditions, separation is driven mainly by hydrophobic interactions. In experiments with ethanolic/aqueous suspensions, when the hydrophobicity of the surfactant was increased by increasing volumes of SPAN 80, the CGA produced were less stable; thus higher recoveries of astaxanthin under conditions that favour hydrophobic interactions were not observed. (C) 2008 Elsevier B.V All rights reserved.
Resumo:
BACKGROUND: There is an increasing interest in obtaining natural products with bioactive properties, using fermentation technology. However, the downstream processing consisting of multiple steps can be complicated, leading to increase in the final cost of the product. Therefore there is a need for integrated, cost-effective and scalable separation processes. RESULTS: The present study investigates the use of colloidal gas aphrons (CGA), which are surfactant-stabilized microbubbles, as a novel method for downstream processing. More particularly, their application for the recovery of astaxanthin from the cells of Phaffia rhodozyma is explored. Research carried out with standard solutions of astaxanthin and CGA generated from the cationic surfactant hexadecyl. trimethyl ammonium bromide (CTAB) showed that up to 90% recovery can be achieved under optimum conditions, i.e., pH 11 with NaOH 0.2 mol L-1. In the case of the cells' suspension from the fermentation broth, three different approaches were investigated: (a) the conventional integrated approach where CGA were applied directly; (b) CGA were applied to the clarified suspension of cells; and finally (c) the in situ approach, where CGA are generated within the clarified suspension of cells. Interestingly, in the case of the whole suspension (approach a) highest recoveries (78%) were achieved under the same conditions found to be optimal for the standard solutions. In addition, up to 97% recovery of total carotenoids could be achieved from the clarified suspension after pretreatment with NaOH. This pretreatment led to maximum cell disruption as well as optimum conditioning for subsequent CGA separation. CONCLUSIONS: These results demonstrate the potential of CGA for the recovery of bioactive components from complex feedstock. (c) 2008 Society of Chemical Industry.
Resumo:
Annatto dyes are widely used in food and are finding increasing interest also for their application in the pharmaceutical and cosmetics industry. Bixin is the main pigment extracted from annatto seeds and accounts for 80% of the carotenoids in the outer coat of the seeds; norbixin being the water-soluble form of the bixin. Typically annatto dyes are extracted from the seeds by mechanical means or solutions of alkali, edible oil or organic solvents, or a combination of the two depending on the desired final product. In this work CGAs are investigated as an alternative separation method for the recovery of norbixin from a raw extraction solution of annatto pigments in KOH. A volume of CGAs generated from a cationic surfactant (CTAB) solution is mixed with a volume of annatto solution and when the mixture is allowed to settle it separates into the top aphron phase and the bottom liquid phase. Potassium norbixinate presented in the annatto solution will interact with the surfactant in the aphron phase, which results in the effective separation of norbixin. Recovery= 94% was achieved at a CTAB to norbixin molar ratio of 3.3. In addition a mechanism of separation is proposed here based on the separation results with the cationic surfactant and an anionic surfactant (bis-2-ethyl hexyl sulfosuccinate, AOT) and measurements of surfactant to norbixin ratio in the aphron phase; electrostatic interactions between the surfactant and norbixin molecules result in the fort-nation of a coloured complex and effective separation of norbixin. (c) 2005 Elsevier B.V. All rights reserved.
Resumo:
The phase separation behaviour in aqueous mixtures of poly(methyl vinyl ether) and hydroxypropylcellulose has been studied by cloud points method and viscometric measurements. The miscibility of these blends in solid state has been assessed by infrared spectroscopy; methanol vapours sorption experiments and scanning electron microscopy. The values of Gibbs energy of mixing of the polymers and their blends with methanol as well as between each other were calculated. It was found that in solid state the polymers can interact with methanol very well but the polymer-polymer interactions are unfavourable. Although in aqueous solutions the polymers exhibit some intermolecular interactions their solid blends are not completely miscible. (C) 2005 Elsevier Ltd. All rights reserved.
Resumo:
Boolean input systems are in common used in the electric industry. Power supplies include such systems and the power converter represents these. For instance, in power electronics, the control variable are the switching ON and OFF of components as thyristors or transistors. The purpose of this paper is to use neural network (NN) to control continuous systems with Boolean inputs. This method is based on classification of system variations associated with input configurations. The classical supervised backpropagation algorithm is used to train the networks. The training of the artificial neural network and the control of Boolean input systems are presented. The design procedure of control systems is implemented on a nonlinear system. We apply those results to control an electrical system composed of an induction machine and its power converter.
Resumo:
There is growing interest, especially for trials in stroke, in combining multiple endpoints in a single clinical evaluation of an experimental treatment. The endpoints might be repeated evaluations of the same characteristic or alternative measures of progress on different scales. Often they will be binary or ordinal, and those are the cases studied here. In this paper we take a direct approach to combining the univariate score statistics for comparing treatments with respect to each endpoint. The correlations between the score statistics are derived and used to allow a valid combined score test to be applied. A sample size formula is deduced and application in sequential designs is discussed. The method is compared with an alternative approach based on generalized estimating equations in an illustrative analysis and replicated simulations, and the advantages and disadvantages of the two approaches are discussed.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
Reactions in (molecular) organic crystalline solids have been shown to be important for exerting control that is unattainable over chemical transformations in solution. Such control has also been achieved for reactions within metal– organic cages. In these examples, the reactants are already in place within the crystals following the original crystal growth. The post-synthetic modification of metal–organic frameworks (MOFs and indeed reactions and catalysis within MOFs have been recently demonstrated; in these cases the reactants enter the crystals through permanent channels. Another growing area of interest within molecular solid-state chemistry is synthesis by mechanical co-grinding of solid reactants—often referred to as mechanochemistry. Finally, in a small number of reported examples, molecules also have been shown to enter nonporous crystals directly from the gas or vapor phase, but in only a few of these examples does a change in covalent bonding result, which indicates that a reaction occurs within the nonporous crystals. It is this latter type of highly uncommon reaction that is the focus of the present study.
Resumo:
We present extensive molecular dynamics simulations of the dynamics of diluted long probe chains entangled with a matrix of shorter chains. The chain lengths of both components are above the entanglement strand length, and the ratio of their lengths is varied over a wide range to cover the crossover from the chain reptation regime to tube Rouse motion regime of the long probe chains. Reducing the matrix chain length results in a faster decay of the dynamic structure factor of the probe chains, in good agreement with recent neutron spin echo experiments. The diffusion of the long chains, measured by the mean square displacements of the monomers and the centers of mass of the chains, demonstrates a systematic speed-up relative to the pure reptation behavior expected for monodisperse melts of sufficiently long polymers. On the other hand, the diffusion of the matrix chains is only weakly perturbed by the diluted long probe chains. The simulation results are qualitatively consistent with the theoretical predictions based on constraint release Rouse model, but a detailed comparison reveals the existence of a broad distribution of the disentanglement rates, which is partly confirmed by an analysis of the packing and diffusion of the matrix chains in the tube region of the probe chains. A coarse-grained simulation model based on the tube Rouse motion model with incorporation of the probability distribution of the tube segment jump rates is developed and shows results qualitatively consistent with the fine scale molecular dynamics simulations. However, we observe a breakdown in the tube Rouse model when the short chain length is decreased to around N-S = 80, which is roughly 3.5 times the entanglement spacing N-e(P) = 23. The location of this transition may be sensitive to the chain bending potential used in our simulations.
Resumo:
We present an efficient strategy for mapping out the classical phase behavior of block copolymer systems using self-consistent field theory (SCFT). With our new algorithm, the complete solution of a classical block copolymer phase can be evaluated typically in a fraction of a second on a single-processor computer, even for highly segregated melts. This is accomplished by implementing the standard unit-cell approximation (UCA) for the cylindrical and spherical phases, and solving the resulting equations using a Bessel function expansion. Here the method is used to investigate blends of AB diblock copolymer and A homopolymer, concentrating on the situation where the two molecules are of similar size.
Resumo:
The physical and empirical relationships used by microphysics schemes to control the rate at which vapor is transferred to ice crystals growing in supercooled clouds are compared with laboratory data to evaluate the realism of various model formulations. Ice crystal growth rates predicted from capacitance theory are compared with measurements from three independent laboratory studies. When the growth is diffusion- limited, the predicted growth rates are consistent with the measured values to within about 20% in 14 of the experiments analyzed, over the temperature range −2.5° to −22°C. Only two experiments showed significant disagreement with theory (growth rate overestimated by about 30%–40% at −3.7° and −10.6°C). Growth predictions using various ventilation factor parameterizations were also calculated and compared with supercooled wind tunnel data. It was found that neither of the standard parameterizations used for ventilation adequately described both needle and dendrite growth; however, by choosing habit-specific ventilation factors from previous numerical work it was possible to match the experimental data in both regimes. The relationships between crystal mass, capacitance, and fall velocity were investigated based on the laboratory data. It was found that for a given crystal size the capacitance was significantly overestimated by two of the microphysics schemes considered here, yet for a given crystal mass the growth rate was underestimated by those same schemes because of unrealistic mass/size assumptions. The fall speed for a given capacitance (controlling the residence time of a crystal in the supercooled layer relative to its effectiveness as a vapor sink, and the relative importance of ventilation effects) was found to be overpredicted by all the schemes in which fallout is permitted, implying that the modeled crystals reside for too short a time within the cloud layer and that the parameterized ventilation effect is too strong.