28 resultados para protonation


Relevância:

10.00% 10.00%

Publicador:

Resumo:

The compound bis[1,1'-N,N'-(2-picolyl) aminomethyl] ferrocene, L-1, was synthesized. The protonation constants of this ligand and the stability constants of its complexes with Ni2+, Cu2+, Zn2+, Cd2+ and Pb2+ were determined in aqueous solution by potentiometric methods at 25degreesC and at ionic strength 0.10 mol dm(-3) in KNO3. The compound L-1 forms only 1:1 (M:L) complexes with Pb2+ and Cd2+ while with Ni2+ and Cu2+ species of 2:1 ratio were also found. The complexing behaviour of L-1 is regulated by the constraint imposed by the ferrocene in its backbone, leading to lower values of stability constants for complexes of the divalent first row transition metals when compared with related ligands. However, the differences in stability are smaller for the larger metal ions. The structure of the copper complex with L-1 was determined by single-crystal X-ray diffraction and shows that a species of 2:2 ratio is formed. The two copper centres display distorted octahedral geometries and are linked through the two L1 bridges at a long distance of 8.781(10) Angstrom. The electrochemical behaviour of L-1 was studied in the presence of Ni2+, Cu2+, Zn2+, Cd2+ and Pb2+, showing that upon complexation the ferrocene-ferrocenium half-wave potential shifts anodically in relation to that of the free ligand. The maximum electrochemical shift (DeltaE(1/2)) of 268 mV was found in the presence of Pb2+, followed by Cu2+ (218 mV), Ni2+ (152 mV), Zn2+ (111 mV) and Cd2+ (110 mV). Moreover, L-1 is able to electrochemically and selectively sense Cu2+ in the presence of a large excess of the other transition metal cations studied.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Resistant strains of Plasmodium falciparum and the unavailability of useful antimalarial vaccines reinforce the need to develop new efficacious antimalarials. This study details a pharmacophore model that has been used to identify a potent, soluble, orally bioavailable antimalarial bisquinoline, metaquine (N,N'-bis(7-chloroquinolin-4-yl)benzene-1,3-diamine) (dihydrochloride), which is active against Plasmodium berghei in vivo (oral ID50 of 25 mu mol/kg) and multidrug-resistant Plasmodium falciparum K1 in vitro (0.17 mu M). Metaquine shows strong affinity for the putative antimalarial receptor, heme at pH 7.4 in aqueous DMSO. Both crystallographic analyses and quantum mechanical calculations (HF/6-31+G*) reveal important regions of protonation and bonding thought to persist at parasitic vacuolar pH concordant with our receptor model. Formation of drug-heme adduct in solution was confirmed using high-resolution positive ion electrospray mass spectrometry. Metaquine showed strong binding with the receptor in a 1: 1 ratio (log K = 5.7 +/- 0.1) that was predicted by molecular mechanics calculations. This study illustrates a rational multidisciplinary approach for the development of new 4-aminoquinoline antimalarials, with efficacy superior to chloroquine, based on the use of a pharmacophore model.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The currently accepted mechanism of trioxane antimalarial action involves generation of free radicals within or near susceptible sites probably arising from the production of distonic radical anions. An alternative mechanistic proposal involving the ionic scission of the peroxide group and consequent generation of a carbocation at C-4 has been suggested to account for antimalarial activity. We have investigated this latter mechanism using DFT (B3LYP/6-31+G* level) and established the preferred Lewis acid protonation sites (artemisinin O5a >> O4a approximate to O3a > O2a > O1a; arteether O4a >= O3a > O5b >> O2a > O1a; Figure 3) and the consequent decomposition pathways and hydrolysis sites. In neither molecule is protonation likely to occur on the peroxide bond O1-O2 and therefore lead to scission. Therefore, the alternative radical pathway remains the likeliest explanation for antimalarial action.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

It has been established that 6-(5,6-dialkyl-1,2,4-triazin-3-yl)-2,2'-bipyridines (R,hemi-BTPs) have properties which are intermediate between those of the terpyridines and the bis(1,2,4-triazin-3-yl)pyridines (BTPs). However, they resemble the terpyridines much more closely than the BTPs. It has been shown that Et, hemi-BTP when dissolved in TPH-a dodecane-like solvent-is a selective reagent for the separation of americium(III) from europium(III). Solution NMR in acetonitrile largely confirmed the crystallographic results. There was no evidence for a 1 : 3 complex cation, or for significant differences between metal(III)-N distances for the pyridine and 1,2,4-triazine rings. Intramolecular hydrogen bonding plays a crucial role in the formation of metal coordination spheres, which explains the differences between the terpyridyl, R,hemi-BTPs and the BTPs. Protonation of the R,hemi-BTPs facilitates a conformational change which is necessary for complexation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The binding properties of dioxadiaza-([17](DBF) N2O2) and trioxadiaza- ([22](DBF)N2O3), macrocyclic ligands containing a rigid dibenzofuran group ( DBF), to metal cations and structural studies of their metal complexes have been carried out. The protonation constants of these two ligands and the stability constants of their complexes with Ca2+, Ba2+, and Mn2+, Co2+, Ni2+, Cu2+, Zn2+ and Cd2+, were determined at 298.2 K in methanol-water ( 1 : 1, v/v), and at ionic strength 0.10 mol dm(-3) in KNO3. The values of the protonation constants of both ligands are similar, indicating that no cavity size effect is observed. Only mononuclear complexes of these ligands with the divalent metal ions studied were found, and their stability constants are lower than expected, especially for the complexes of the macrocycle with smaller cavity size. However, the Cd2+ complex with [ 17]( DBF) N2O2 exhibits the highest value of stability constant for the whole series of metal ions studied, indicating that this ligand reveals a remarkable selectivity for cadmium(II) in the presence of all the metal ions studied, except copper( II), indicating that this ligand reveals a remarkable selectivity for cadmium( II) in the presence of the mentioned metal ions. The crystal structures of H-2[17](DBF)N2O32+ (diprotonated form of the ligand) and of its cadmium complex were determined by X-ray diffraction. The Cd2+ ion fits exactly inside the macrocyclic cavity exhibiting coordination number eight by coordination to all the donor atoms of the ligand, and additionally to two oxygen atoms from one nitrate anion and one oxygen atom from a water molecule. The nickel( II) and copper( II) complexes with the two ligands were further studied by UV-vis-NIR and the copper( II) complexes also by EPR spectroscopic techniques in solution indicating square-pyramidal structures and suggesting that only one nitrogen and oxygen donors of the ligands are bound to the metal. However an additional weak interaction of the second nitrogen cannot be ruled out.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A series of multicarboxylic acid appended imidazolium ionic liquids ( McaILs) with chloride [ Cl](-) or bromide [ Br](-) as anions have been synthesized and characterized. Deprotonation of these ionic acids gives the corresponding zwitterions. Re-protonation of the zwitterions with strong Bronsted acids gives a series of new ionic acid-adducts, many of which remained as room-temperature ionic liquids. A new catalytic system, McaIL/PdCl2 for the selective catalytic oxidation of styrene to acetophenone with hydrogen peroxide as an oxidant has been attempted. In the presence of McaILs, it is found that the quantity of palladium chloride PdCl2 used can be greatly reduced while the activity ( TOF) and selectivity towards acetophenone are enhanced sharply. It is also shown that the catalytic properties of this system could be finely tuned through the molecular design of the McaILs. The best TOF value obtained so far is 146 h(-1) with 100% conversion of styrene at 93% selectivity to acetophenone. In addition, the catalytic activity has been maintained for at least ten catalytic cycles.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The ligands 1,4,8,11-tetraazacyclotetradecane-1,4,8-triacetic-11-methylphosphonic acid (H(5)te3a1p) and 1,4,8,11-tetraazacyclotetradecane-1,4,8-triacetic acid (H(3)te3a) were synthesized, the former one for the first time. The syntheses of these ligands were achieved from reactions on 1,4,8,11-tetraazacyclotetradecane-1,4,8-tris( carbamoylmethyl) hydroiodide (te3am center dot HI), and compounds (Hte3am)(+), 1, and (H(7)te3a1p)(2+), 4, were characterized by X-ray diffraction. Structures of two other compounds resulting from side-reactions, (H(2)te2lac)(2+), 2, and (H(4)te2a2p(OEt2))(2+), 3, were also determined by X-ray diffraction. Potentiometric titrations of H(5)te3a1p and H(3)te3a were performed at 298.2 K and ionic strength 0.10 mol dm(-3) in NMe4NO3 to determine their protonation constants. H-1 and P-31 NMR titrations of H(5)te3a1p were carried out in order to determine the very high first protonation constant of this ligand and to elucidate the sequence of protonation. Potentiometric studies of the two ligands with Ca2+, Mn2+, Co2+, Ni2+, Cu2+, Zn2+, Cd2+ and Pb2+ metal ions performed in the same experimental conditions showed that the complexes of H5te3a1p present very high thermodynamic stability while complexes of H(3)te3a, particularly Co2+ and Zn2+, are even more stable. P-31 NMR spectra of the cadmium(II) complex of H(5)te3a1p showed that the phosphonate moiety was coordinated to the metal ion. The UV-vis-NIR spectroscopic data and magnetic moment values of Co2+ and Ni2+ complexes of H(5)te3a1p and H(3)te3a together with the EPR of the corresponding Cu2+ complexes indicated that all these complexes adopt distorted octahedral coordination geometries in solution. This was confirmed by the single crystal structure of [Cu-2(Hte3a)(H2O)(3)Cl]Cl-0.5(ClO4)(0.5) center dot 2H(2)O that showed two distorted octahedral copper centres bridged by a N-acetate pendant arm with a Cu center dot center dot center dot Cu distance of 4.890(1) angstrom. The first one is encapsulated into the macrocyclic cavity surrounded by four nitrogen and two oxygen donors from the macrocycle, whereas the second one is on the periphery of the macrocycle and is coordinated to two oxygen atoms of one acetate pendant arm in chelating fashion, one chloride and three water molecules.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Electrochemical and photochemical properties of the tetrahedral cluster [Ru3Ir(mu(3)-H)(CO)(13)] were studied in order to prove whether the previously established thermal conversion of this cluster into the hydrogenated derivative [Ru3Ir(mu-H)(3)(CO)(12)] also occurs by means of redox or photochemical activation. Two-electron reduction of [Ru3Ir(mu(3)-H)(CO)(13)] results in the loss of CO and concomitant formation of the dianion [Ru3Ir(mu(3)-H)(CO)(12)](2-). The latter reduction product is stable in CH2Cl2 at low temperatures but becomes partly protonated above 283 K into the anion [Ru3Ir(mu-H)(2)(CO)(12)](-) by traces of water. The dianion [Ru3Ir(mu(3)-H)(CO)(12)](2-) is also the product of the electrochemical reduction of [Ru3Ir(mu-H)(3)(CO)(12)] accompanied by the loss of H-2. Stepwise deprotonation of [Ru3Ir(mu-H)(3)(CO)(12)] with Et4NOH yields [Ru3Ir(mu-H)(2)(CO)(12)](-) and [Ru3Ir(mu(3)-H)(CO)(12)](2-). Reverse protonation of the anionic clusters can be achieved, e. g., with trifluoromethylsulfonic acid. Thus, the electrochemical conversion of [Ru3Ir(mu(3)-H)(CO)(13)] into [Ru3Ir(mu-H)(3)(CO)(12)] is feasible, demanding separate two-electron reduction and protonation steps. Irradiation into the visible absorption band of [Ru3Ir(mu3-H)(CO)(13)] in hexane does not induce any significant photochemical conversion. Irradiation of this cluster in the presence of CO with lambda(irr) > 340 nm, however, triggers its efficient photofragmentation into reactive unsaturated ruthenium and iridium carbonyl fragments. These fragments are either stabilised by dissolved CO or undergo reclusterification to give homonuclear clusters. Most importantly, in H-2-saturated hexane, [Ru3Ir(mu(3)-H)(CO)(13)] converts selectively into the [Ru3Ir(mu-H)(3)(CO)(12)] photoproduct. This conversion is particularly efficient at lambda(irr) > 340 nm.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The rigid [6]ferrocenophane, L-1, was synthesised by condensation of 1,1'-ferrocene dicarbaldehyde with trans-1,2-diaminocyclohexane in high dilution at r.t. followed by reduction. When other experimental conditions were employed, the [6,6,6]ferrocenephane (L-2) was also obtained. Both compounds were characterised by single crystal X-ray crystallography. The protonation of L-1 and its metal complexation were evaluated by the effect on the electron-transfer process of the ferrocene (fc) unit of L-1 using cyclic voltammetry (CV) and square wave voltammetry (SWV) in anhydrous CH3CN solution and in 0.1 M (Bu4NPF6)-Bu-n as the supporting electrolyte. The electrochemical process of L-1 between 300 and 900 mV is complicated by amine oxidation. On the other hand, an anodic shift from the fc/fc(+) wave of L-1 of 249, 225, 81 and 61 mV was observed by formation of Zn2+, Ni2+, Pd2+ and Cu2+ complexes, respectively. Whereas Mg2+ and Ca2+ only have with L-1 weak interactions and they promote the acid-base equilibrium of L-1. This reveals that L-1 is an interesting molecular redox sensor for detection of Zn2+ and Ni2+, although the kinetics of the Zn2+ complex formation is much faster than that of the Ni2+ one. The X-ray crystal structure of [(PdLCl2)-Cl-1] was determined and showed a square-planar environment with Pd(II) and Fe(II) centres separated by 3.781(1) angstrom. The experimental anodic shifts were elucidated by DFT calculations on the [(MLCl2)-Cl-1] series and they are related to the nature of the HOMO of these complexes and a four-electron, two-orbital interaction.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The isotropic crystallographic model of the structure of xylanase I from Thermoascus aurantiacus (TAXI) has now been refined anisotropically at 1.14 Å resolution to a standard residual of R = 11.1% for all data. TAXI is amongst the five largest proteins deposited in the Protein Data Bank to have been refined with anisotropic displacement parameters (ADPs) at this level of resolution. The anisotropy analysis revealed a more isotropic distribution of anisotropy than usually observed previously. Adding ADPs resulted in high-quality electron-density maps which revealed discrepancies from the previously suggested primary sequences for this enzyme. Side-chain conformational disorder was modelled for 16 residues, including Trp275, a bulky residue at the active site. An unrestrained refinement was consistent with the protonation of the catalytic acid/base glutamate and the deprotonation of the nucleophile glutamate, as required for catalysis. The thermal stability of TAXI is reinterpreted in the light of the new refined model.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Two pentaaza macrocycles containing pyridine in the backbone, namely 3,6,9,12,18-pentaazabicyclo[12.3.1] octadeca-1(18),14,16-triene ([15]pyN(5)), and 3,6,10,13,19-pentaazabicyclo[13.3.1]nonadeca-1(19),15,17-triene ([16]pyN(5)), were synthesized in good yields. The acid-base behaviour of these compounds was studied by potentiometry at 298.2 K in aqueous solution and ionic strength 0.10 M in KNO3. The protonation sequence of [15]pyN(5) was investigated by H-1 NMR titration that also allowed the determination of protonation constants in D2O. Binding studies of the two ligands with Ca2+, Ni2+, Cu2+, Zn2+, Cd2+, and Pb2+ metal ions were performed under the same experimental conditions. The results showed that all the complexes formed with the 15-membered ligand, particularly those of Cu2+ and especially Ni2+, are thermodynamically more stable than with the larger macrocycle. Cyclic voltammetric data showed that the copper(II) complexes of the two macrocycles exhibited analogous behaviour, with a single quasi-reversible one-electron transfer reduction process assigned to the Cu(II)/Cu(I) couple. The UV-visible-near IR spectroscopic and magnetic moment data of the nickel(II) complexes in solution indicated a tetragonal distorted coordination geometry for the metal centre. X-band EPR spectra of the copper(II) complexes are consistent with distorted square pyramidal geometries. The crystal structure of [Cu([15]pyN(5))](2+) determined by X-ray diffraction showed the copper(II) centre coordinated to all five macrocyclic nitrogen donors in a distorted square pyramidal environment.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Group 6 complexes of the type [M(CO)4(bpy)] (M=Cr, Mo, W) are capable of behaving as electrochemical catalysts for the reduction of CO2 at potentials less negative than those for the reduction of the radical anions [M(CO)4(bpy)].−. Cyclic voltammetric, chronoamperometric and UV/Vis/IR spectro-electrochemical data reveal that five-coordinate [M(CO)3(bpy)]2− are the active catalysts. The catalytic conversion is significantly more efficient in N-methyl-2-pyrrolidone (NMP) compared to tetrahydrofuran, which may reflect easier CO dissociation from 1e−-reduced [M(CO)4(bpy)].− in the former solvent, followed by second electron transfer. The catalytic cycle may also involve [M(CO)4(H-bpy)]− formed by protonation of [M(CO)3(bpy)]2−, especially in NMP. The strongly enhanced catalysis using an Au working electrode is remarkable, suggesting that surface interactions may play an important role, too.